Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32364
Trapped Gene
Pten (ENSMUSG00000013663)
Vector Insertion
Chr 19: 32833014 - 32850504
Public Clones (sanger) PST22435-NR (escells) IST14434E2 (tigm) IST14312C10 (tigm)
IST10539E10 (tigm) IST14312C10 (tigm) IST14572D5 (tigm) IST10879B10 (tigm)
IST11001B3 (tigm) IST11360E10 (tigm) IST10860F1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000545317 (Chr19:32832089..32833013 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000545317 (Chr19:32832089..32833013 +)
Downstram Exon
ENSMUSE00000348178 (Chr19:32850505..32850589 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000545317 Chr19:32832089..32833013 No primer for this exon

*** Putative Vector Insertion (Chr 19: 32833014 - 32850504) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000348178 Chr19:32850505..32850589 No primer for this exon
downstream ENSMUSE00000146019 Chr19:32867039..32867083 No primer for this exon
downstream ENSMUSE00000146017 Chr19:32872561..32872604 No primer for this exon
downstream ENSMUSE00000146011 Chr19:32874351..32874589 No primer for this exon
downstream ENSMUSE00000146009 Chr19:32886186..32886327 No primer for this exon
downstream ENSMUSE00000146006 Chr19:32889907..32890073 No primer for this exon
downstream ENSMUSE00000146015 Chr19:32892326..32892550 No primer for this exon
downstream ENSMUSE00000620052 Chr19:32894333..32894554 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTGCCCTCAGTTTAATCG Chr19:32833051..32833071 59.7 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATAACCGTGACTGGGAAA Chr19:32833058..32833078 58.97 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013663