Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32367
Trapped Gene
Stx2 (ENSMUSG00000029428)
Vector Insertion
Chr 5: 129505384 - 129514377
Public Clones IST12852G8 (tigm) IST12234G5 (tigm) IST12771G1 (tigm) IST12775H5 (tigm)
IST12234F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000458782 (Chr5:129514269..129514376 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000458782 (Chr5:129514269..129514376 -)
Downstram Exon
ENSMUSE00000312523 (Chr5:129505385..129505462 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTCTCCACAATGACGACAGC Chr5:129505394..129505413 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458782 Chr5:129514269..129514376 No primer for this exon
upstream ENSMUSE00000312523 Chr5:129505385..129505462 GCTGTCGTCATTGTGGAGAA Chr5:129505416..129505435 59.84 50

*** Putative Vector Insertion (Chr 5: 129505384 - 129514377) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000188821 Chr5:129502237..129502336 TGCTGCTTCGAATCTCCTCT Chr5:129502293..129502312 60.24 50
downstream ENSMUSE00000188827 Chr5:129500671..129500745 TTGTTCAGGTCCTCCAGCTC Chr5:129500693..129500712 60.39 55
downstream ENSMUSE00000188831 Chr5:129499370..129499443 CCATTCTCGTCCTGATCACA Chr5:129499388..129499407 59.63 50
downstream ENSMUSE00000536434 Chr5:129498055..129498163 AACAGGATCTGCGCTTCATT Chr5:129498077..129498096 59.84 45
downstream ENSMUSE00000188834 Chr5:129497078..129497151 ATCTCTTCCAGCTCGTCGTC Chr5:129497093..129497112 59.56 55
downstream ENSMUSE00000489041 Chr5:129496839..129496976 TGAACATCTCGTGCAGCTCT Chr5:129496846..129496865 59.73 50
downstream ENSMUSE00000188833 Chr5:129494677..129494787 CGTCTCTTCCTTGGCATGTT Chr5:129494691..129494710 60.26 50
downstream ENSMUSE00000188836 Chr5:129493593..129493717 CTACGCAATCATTTGCCAAC Chr5:129493607..129493626 59.19 45
downstream ENSMUSE00000406473 Chr5:129490442..129492305 CACACACCCCTGATTCACTG Chr5:129490561..129490580 60 55
downstream ENSMUSE00000649420 Chr5:129490442..129492305 CACACACCCCTGATTCACTG Chr5:129490561..129490580 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCATGGACGGTTTCTTCC Chr5:129514388..129514408 59.91 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTCATGGACGGTTTCTTCC Chr5:129514388..129514409 60.18 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029428