Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32368
Trapped Gene
RP24-399O5.1 (ENSMUSG00000042761)
Vector Insertion
Chr 9: 87039993 - 87064359
Public Clones IST11999D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000694504 (Chr9:87039812..87039992 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGCCCCGGATATTGTACT Chr9:87039827..87039846 60.17 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000694504 (Chr9:87039812..87039992 +)
Downstram Exon
ENSMUSE00000235357 (Chr9:87064360..87064493 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGCCCCGGATATTGTACT Chr9:87039827..87039846 60.17 55 AGGAAACTGGTCCGATCTCA Chr9:87064472..87064491 59.65 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694506 Chr9:87039141..87039232 GGAGGAGCTGAACCGTGTAA Chr9:87039185..87039204 60.26 55
upstream ENSMUSE00000694504 Chr9:87039812..87039992 GGAGCCCCGGATATTGTACT Chr9:87039827..87039846 60.17 55

*** Putative Vector Insertion (Chr 9: 87039993 - 87064359) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235357 Chr9:87064360..87064493 AGGAAACTGGTCCGATCTCA Chr9:87064472..87064491 59.65 50
downstream ENSMUSE00000712538 Chr9:87064360..87064493 AGGAAACTGGTCCGATCTCA Chr9:87064472..87064491 59.65 50
downstream ENSMUSE00000235341 Chr9:87070629..87070728 ATCACAAAGACCGCAAGACC Chr9:87070677..87070696 60.12 50
downstream ENSMUSE00000694501 Chr9:87077276..87077666 TCACAAAGTTGGGGATGTCA Chr9:87077562..87077581 59.94 45
downstream ENSMUSE00000694502 Chr9:87077276..87078880 CCAGACAGGCCACCTTACAT Chr9:87078127..87078146 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCGATGTTACGAATTCCAC Chr9:87060988..87061008 60.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCGATGTTACGAATTCCAC Chr9:87060988..87061008 60.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042761