Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32385
Trapped Gene
1700061G19Rik (ENSMUSG00000024209)
Vector Insertion
Chr 17: 57022114 - 57022202
Public Clones IST13321F7 (tigm) IST12689F9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000283830 (Chr17:57021964..57022113 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTGAAGCCCAATCAGTGCT Chr17:57022029..57022048 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000283830 (Chr17:57021964..57022113 +)
Downstram Exon
ENSMUSE00000139757 (Chr17:57022203..57022409 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTGAAGCCCAATCAGTGCT Chr17:57022029..57022048 59.87 50 GAAGCAAAGTGGCAGGTAGC Chr17:57022301..57022320 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000284015 Chr17:57014906..57015103 TGATAAAGTGGCAGCCTGTG Chr17:57015009..57015028 59.86 50
upstream ENSMUSE00000283990 Chr17:57015511..57015819 CTGTGGACACCTGGTCCTCT Chr17:57015611..57015630 60.15 60
upstream ENSMUSE00000283969 Chr17:57016786..57017012 GCAACTGCTCACCTACATCG Chr17:57016949..57016968 59.47 55
upstream ENSMUSE00000376498 Chr17:57019874..57019962 GTCTGGAACGCTTTCATGGT Chr17:57019878..57019897 60.12 50
upstream ENSMUSE00000283885 Chr17:57020369..57020489 TCGCTGAGACCTCAGAAATG Chr17:57020422..57020441 59.11 50
upstream ENSMUSE00000493939 Chr17:57021590..57021670 TCCAGGGCTACTTGAAGCAT Chr17:57021591..57021610 59.84 50
upstream ENSMUSE00000283830 Chr17:57021964..57022113 ACTGAAGCCCAATCAGTGCT Chr17:57022029..57022048 59.87 50

*** Putative Vector Insertion (Chr 17: 57022114 - 57022202) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139757 Chr17:57022203..57022409 GAAGCAAAGTGGCAGGTAGC Chr17:57022301..57022320 60.02 55
downstream ENSMUSE00000139751 Chr17:57022739..57022920 CAGCTTCTTGTTGGTGTGGA Chr17:57022915..57022934 59.87 50
downstream ENSMUSE00000283755 Chr17:57023050..57023283 ACTCCGACAAGCCGTACAAC Chr17:57023237..57023256 60.18 55
downstream ENSMUSE00000139749 Chr17:57024174..57024391 CCACCTTCCTCTCTGTGCTC Chr17:57024313..57024332 59.99 60
downstream ENSMUSE00000139761 Chr17:57024507..57024646 GGGATACGGGTTGACCATTT Chr17:57024553..57024572 60.81 50
downstream ENSMUSE00000283440 Chr17:57025864..57026110 AGGTTACTCCGAGCCTCTCC Chr17:57025907..57025926 59.84 60
downstream ENSMUSE00000693744 Chr17:57028060..57028327 GGCGCTTGAACGAAGATTAG Chr17:57028182..57028201 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAGCCATGACAACGTGAG Chr17:57022100..57022120 60.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGACGTGACTGGGAAAAC Chr17:57022160..57022180 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024209