Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32386
Trapped Gene
Lrch4 (ENSMUSG00000029720)
Vector Insertion
Chr 5: 138075478 - 138077966
Public Clones IST12800G10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000192069 (Chr5:138075372..138075477 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTCGAAGGAACCAGCTCAG Chr5:138075444..138075463 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000192069 (Chr5:138075372..138075477 +)
Downstram Exon
ENSMUSE00000192068 (Chr5:138077967..138078103 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTCGAAGGAACCAGCTCAG Chr5:138075444..138075463 59.99 55 CTGTAGGGGGTTGCTATCCA Chr5:138078091..138078110 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000192065 Chr5:138070406..138070654 CCGCAGTTACGACTTGTCAG Chr5:138070620..138070639 59.51 55
upstream ENSMUSE00000192071 Chr5:138074800..138074944 ACAGCCCTCACCTACCTCAA Chr5:138074919..138074938 59.72 55
upstream ENSMUSE00000192063 Chr5:138075077..138075203 GTCGTTGCCACCCTACATCT Chr5:138075092..138075111 60 55
upstream ENSMUSE00000192069 Chr5:138075372..138075477 GTTCGAAGGAACCAGCTCAG Chr5:138075444..138075463 59.99 55

*** Putative Vector Insertion (Chr 5: 138075478 - 138077966) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000192068 Chr5:138077967..138078103 CTGTAGGGGGTTGCTATCCA Chr5:138078091..138078110 59.95 55
downstream ENSMUSE00000192059 Chr5:138078213..138078325 GCCAGCTTCCATTGTTAGGT Chr5:138078269..138078288 59.2 50
downstream ENSMUSE00000192070 Chr5:138078441..138078540 TAACGACGTCCCGGAAATAA Chr5:138078476..138078495 60.31 45
downstream ENSMUSE00000192061 Chr5:138078773..138078863 ATCCGGAAAGACAGCTCTGA Chr5:138078810..138078829 59.95 50
downstream ENSMUSE00000192064 Chr5:138078954..138079030 TCAGCTGCACTTCGATCTTC Chr5:138079032..138079051 59.27 50
downstream ENSMUSE00000192055 Chr5:138079133..138079194 TTCTCCACATCCCCTGCTAC Chr5:138079182..138079201 60.07 55
downstream ENSMUSE00000192062 Chr5:138079294..138079410 GCCACAACTGCAAAGTGTCT Chr5:138079352..138079371 58.94 50
downstream ENSMUSE00000192058 Chr5:138079521..138079589 No primer for this exon
downstream ENSMUSE00000192067 Chr5:138079667..138079770 CTCCCAGTTGGGTAGTGCTG Chr5:138079704..138079723 60.7 60
downstream ENSMUSE00000192057 Chr5:138079883..138079966 AAGAGGACCGGAAGAGGAAG Chr5:138079954..138079973 59.81 55
downstream ENSMUSE00000192056 Chr5:138080350..138080426 GCCGAGGTCTCAAAACAGAC Chr5:138080388..138080407 59.85 55
downstream ENSMUSE00000192066 Chr5:138080578..138080715 TCTGCCAGGTCCTCAGGTAG Chr5:138080627..138080646 60.4 60
downstream ENSMUSE00000192060 Chr5:138080806..138080883 TCCGACAGGCTTCTAGGAAA Chr5:138080869..138080888 59.95 50
downstream ENSMUSE00000590794 Chr5:138081176..138081373 AGGAGCCGAGTGTAGACGAC Chr5:138081366..138081385 59.48 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTTCGAAGGAACCAGCTCAG Chr5:138075445..138075465 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCGAAGGAACCAGCTCAG Chr5:138075445..138075465 59.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029720