Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32388
Trapped Gene
Gm98 (ENSMUSG00000036098)
Vector Insertion
Chr 19: 10295667 - 10297731
Public Clones IST12354D5 (tigm) IST12354D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000694434 (Chr19:10297607..10297730 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGACCCCAACTACCAATC Chr19:10297673..10297692 59.65 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000694434 (Chr19:10297607..10297730 -)
Downstram Exon
ENSMUSE00000694432 (Chr19:10295668..10295863 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGACCCCAACTACCAATC Chr19:10297673..10297692 59.65 50 GTCCACACGATAGGTGAGCA Chr19:10295817..10295836 59.71 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000715443 Chr19:10315049..10315238 No primer for this exon
upstream ENSMUSE00000715898 Chr19:10315049..10315238 No primer for this exon
upstream ENSMUSE00000621344 Chr19:10303510..10303597 No primer for this exon
upstream ENSMUSE00000694441 Chr19:10303510..10303597 No primer for this exon
upstream ENSMUSE00000621366 Chr19:10303143..10303406 CCCACTCAACTGCAACAACA Chr19:10303231..10303250 60.76 50
upstream ENSMUSE00000694439 Chr19:10303143..10303406 CCCACTCAACTGCAACAACA Chr19:10303231..10303250 60.76 50
upstream ENSMUSE00000621365 Chr19:10299939..10300000 TACTCCCCTCAGCAGGTGAA Chr19:10299941..10299960 60.79 55
upstream ENSMUSE00000694437 Chr19:10299939..10300000 TACTCCCCTCAGCAGGTGAA Chr19:10299941..10299960 60.79 55
upstream ENSMUSE00000621363 Chr19:10298862..10299141 CTGCAACGGGACCTCTACAT Chr19:10298982..10299001 60.13 55
upstream ENSMUSE00000694436 Chr19:10298862..10299141 CTGCAACGGGACCTCTACAT Chr19:10298982..10299001 60.13 55
upstream ENSMUSE00000415819 Chr19:10297807..10298057 CTGAACGGAATGATCAAGCA Chr19:10297968..10297987 59.8 45
upstream ENSMUSE00000694435 Chr19:10297807..10298057 CTGAACGGAATGATCAAGCA Chr19:10297968..10297987 59.8 45
upstream ENSMUSE00000621362 Chr19:10297607..10297730 TTGGACCCCAACTACCAATC Chr19:10297673..10297692 59.65 50
upstream ENSMUSE00000694434 Chr19:10297607..10297730 TTGGACCCCAACTACCAATC Chr19:10297673..10297692 59.65 50
upstream ENSMUSE00000621361 Chr19:10295668..10295863 TGCTCACCTATCGTGTGGAC Chr19:10295839..10295858 59.71 55
upstream ENSMUSE00000694432 Chr19:10295668..10295863 TGCTCACCTATCGTGTGGAC Chr19:10295839..10295858 59.71 55

*** Putative Vector Insertion (Chr 19: 10295667 - 10297731) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000621360 Chr19:10294285..10294361 AGGGCCTCTTGCTTCTGTCT Chr19:10294276..10294295 60.53 55
downstream ENSMUSE00000694424 Chr19:10294285..10294361 AGGGCCTCTTGCTTCTGTCT Chr19:10294276..10294295 60.53 55
downstream ENSMUSE00000621359 Chr19:10294012..10294122 TTGGCAGTGGTCTCACTGAA Chr19:10294029..10294048 60.44 50
downstream ENSMUSE00000694421 Chr19:10294012..10294122 TTGGCAGTGGTCTCACTGAA Chr19:10294029..10294048 60.44 50
downstream ENSMUSE00000226548 Chr19:10293528..10293618 GGGCTGCCAGTGTGTAGTTC Chr19:10293532..10293551 60.72 60
downstream ENSMUSE00000643189 Chr19:10293528..10293618 GGGCTGCCAGTGTGTAGTTC Chr19:10293532..10293551 60.72 60
downstream ENSMUSE00000226522 Chr19:10292954..10293154 GATCGGAAGGGTGCATAAGA Chr19:10292958..10292977 60.04 50
downstream ENSMUSE00000226500 Chr19:10292638..10292749 CAGCGAACTCAGGCTTGTATC Chr19:10292652..10292672 60.03 52.38
downstream ENSMUSE00000621358 Chr19:10291910..10292019 ACATCCCCTGTGTCCTTCAC Chr19:10291937..10291956 59.82 55
downstream ENSMUSE00000621357 Chr19:10291108..10291268 CCTGAGCTGCCAGTTGACTT Chr19:10291095..10291114 60.59 55
downstream ENSMUSE00000621356 Chr19:10290910..10290982 CAGTTTAGGGGGCCTCTTTT Chr19:10290897..10290916 59.59 50
downstream ENSMUSE00000621355 Chr19:10290551..10290639 TGCAGAAAACGCTGACTGAT Chr19:10290568..10290587 59.6 45
downstream ENSMUSE00000621334 Chr19:10290232..10290639 CTGCAGAAAACGCTGACTGA Chr19:10290567..10290586 60.32 50
downstream ENSMUSE00000621354 Chr19:10290232..10290300 CGCAGGCTCAGCACATATAG Chr19:10290240..10290259 59.61 55
downstream ENSMUSE00000621342 Chr19:10289764..10289844 AGGGCCAGAAGACAGGAAGT Chr19:10289787..10289806 60.25 55
downstream ENSMUSE00000621341 Chr19:10289507..10289592 GTAGTCCGGTGGTCATGGAG Chr19:10289512..10289531 60.39 60
downstream ENSMUSE00000694388 Chr19:10289507..10289595 GTAGTCCGGTGGTCATGGAG Chr19:10289512..10289531 60.39 60
downstream ENSMUSE00000549522 Chr19:10289250..10289417 AGTGCTTGGGGTTAGAGCTG Chr19:10289231..10289250 59.5 55
downstream ENSMUSE00000694387 Chr19:10289250..10289417 AGTGCTTGGGGTTAGAGCTG Chr19:10289231..10289250 59.5 55
downstream ENSMUSE00000621352 Chr19:10288549..10288800 CCAGGATTTGGCTCTGATGT Chr19:10288726..10288745 60.07 50
downstream ENSMUSE00000694386 Chr19:10288549..10288800 CCAGGATTTGGCTCTGATGT Chr19:10288726..10288745 60.07 50
downstream ENSMUSE00000621351 Chr19:10286932..10287019 AGCACCTTCTGGCACACAGT Chr19:10286915..10286934 60.93 55
downstream ENSMUSE00000694384 Chr19:10286932..10287019 AGCACCTTCTGGCACACAGT Chr19:10286915..10286934 60.93 55
downstream ENSMUSE00000621350 Chr19:10286636..10286710 GGTAGGTGAAGTTGCCAAGC Chr19:10286669..10286688 59.74 55
downstream ENSMUSE00000694382 Chr19:10286636..10286710 GGTAGGTGAAGTTGCCAAGC Chr19:10286669..10286688 59.74 55
downstream ENSMUSE00000621349 Chr19:10286198..10286303 CTGCACAGTACCACGGACAC Chr19:10286249..10286268 60.23 60
downstream ENSMUSE00000694381 Chr19:10286198..10286303 CTGCACAGTACCACGGACAC Chr19:10286249..10286268 60.23 60
downstream ENSMUSE00000621348 Chr19:10285089..10285163 ATTCACGGAAGGACAGGATG Chr19:10285096..10285115 59.93 50
downstream ENSMUSE00000694380 Chr19:10285089..10285163 ATTCACGGAAGGACAGGATG Chr19:10285096..10285115 59.93 50
downstream ENSMUSE00000643188 Chr19:10283795..10284955 AGGAGGCTGTTCCCTCTAGC Chr19:10284641..10284660 59.98 60
downstream ENSMUSE00000694378 Chr19:10283795..10284955 AGGAGGCTGTTCCCTCTAGC Chr19:10284641..10284660 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGACAGTGACAGCCTCAG Chr19:10297701..10297721 59.6 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGACAGTGACAGCCTCAG Chr19:10297701..10297721 59.6 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036098