Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3240
Trapped Gene
Pigf (ENSMUSG00000024145)
Vector Insertion
Chr 17: 87396908 - 87408142
Public Clones AL0477 (sanger) AX0494 (sanger) CMHD-GT_388B12-3 (cmhd)
Private Clones OST1637 (lexicon) OST1616 (lexicon) OST1099 (lexicon) OST938 (lexicon)
OST928 (lexicon) OST893 (lexicon)
Severity of mutation (?) Insertion after 83% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000138677 (Chr17:87408143..87408251 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCCACTGGATTGGGAAAGA Chr17:87408152..87408171 60.43 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000138677 (Chr17:87408143..87408251 -)
Downstram Exon
ENSMUSE00000138679 (Chr17:87396599..87396907 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCCACTGGATTGGGAAAGA Chr17:87408152..87408171 60.43 45 TCCAGAGTGGCGAGATAACC Chr17:87396813..87396832 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000138681 Chr17:87424638..87424730 No primer for this exon
upstream ENSMUSE00000138675 Chr17:87423005..87423253 TTCATTCCGTCCTTCTTCGT Chr17:87423141..87423160 59.67 45
upstream ENSMUSE00000138683 Chr17:87421199..87421290 GTAACGCGAGCTTTGAAATG Chr17:87421271..87421290 58.58 45
upstream ENSMUSE00000138685 Chr17:87419741..87419857 GACCAAACCTCAAAGCATGG Chr17:87419764..87419783 60.49 50
upstream ENSMUSE00000138677 Chr17:87408143..87408251 TTCCACTGGATTGGGAAAGA Chr17:87408152..87408171 60.43 45

*** Putative Vector Insertion (Chr 17: 87396908 - 87408142) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138679 Chr17:87396599..87396907 TCCAGAGTGGCGAGATAACC Chr17:87396813..87396832 60.22 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TACCCTCTTAATCGCCTTGC Chr17:87402079..87402099 59.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCTTGGAGCATTTCCTAT Chr17:87402169..87402189 59.67 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024145