Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32402
Trapped Gene
Numb (ENSMUSG00000021224)
Vector Insertion
Chr 12: 85196389 - 85217763
Public Clones (sanger) IST14461D2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720984 (Chr12:85217618..85217762 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720984 (Chr12:85217618..85217762 -)
Downstram Exon
ENSMUSE00000720883 (Chr12:85196390..85196474 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720541 Chr12:85262768..85262884 No primer for this exon
upstream ENSMUSE00000720984 Chr12:85217618..85217762 No primer for this exon
upstream ENSMUSE00000720883 Chr12:85196390..85196474 No primer for this exon

*** Putative Vector Insertion (Chr 12: 85196389 - 85217763) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000401313 Chr12:85183168..85183311 No primer for this exon
downstream ENSMUSE00000714834 Chr12:85183168..85183308 No primer for this exon
downstream ENSMUSE00000115780 Chr12:85172872..85172946 No primer for this exon
downstream ENSMUSE00000115777 Chr12:85166209..85166241 No primer for this exon
downstream ENSMUSE00000530938 Chr12:85152236..85152310 No primer for this exon
downstream ENSMUSE00000115776 Chr12:85149051..85149191 No primer for this exon
downstream ENSMUSE00000115771 Chr12:85144730..85144934 No primer for this exon
downstream ENSMUSE00000115779 Chr12:85141963..85142256 No primer for this exon
downstream ENSMUSE00000115778 Chr12:85140458..85140607 No primer for this exon
downstream ENSMUSE00000115781 Chr12:85138147..85138293 No primer for this exon
downstream ENSMUSE00000354039 Chr12:85134984..85137104 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTGGGCTTGGGAGTTAAT Chr12:85214708..85214728 60.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTTCGTGACTGGGAAAACC Chr12:85214696..85214716 62.78 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021224