Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32404
Trapped Gene
4931422A03Rik (ENSMUSG00000046085)
Vector Insertion
Chr 2: 103834041 - 103866370
Public Clones (sanger) (sanger) IST13004E2 (tigm) IST14262D4 (tigm) IST14793D11 (tigm)
IST11655C5 (tigm) IST14262D4 (tigm) IST11655C5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000442093 (Chr2:103866287..103866369 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAAAGACGTCACAGGTCA Chr2:103866320..103866339 59.72 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000442093 (Chr2:103866287..103866369 -)
Downstram Exon
ENSMUSE00000442069 (Chr2:103834042..103834069 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAAAGACGTCACAGGTCA Chr2:103866320..103866339 59.72 50 CATCCGGATTCTCTGTTATGG Chr2:103834021..103834041 59.4 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000348628 Chr2:103867935..103868465 GGTCCCTGTAGTCCACGAAG Chr2:103868097..103868116 59.57 60
upstream ENSMUSE00000442075 Chr2:103867379..103867444 No primer for this exon
upstream ENSMUSE00000442093 Chr2:103866287..103866369 CCAAAAGACGTCACAGGTCA Chr2:103866320..103866339 59.72 50
upstream ENSMUSE00000442069 Chr2:103834042..103834069 No primer for this exon

*** Putative Vector Insertion (Chr 2: 103834041 - 103866370) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000442086 Chr2:103832652..103832980 ATTCTTCACTGCCTGGATGG Chr2:103832659..103832678 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACAGCAGGTGATTCACAA Chr2:103842335..103842355 58.78 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATTTCGTGACTGGGAAAACC Chr2:103842303..103842324 58.94 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046085