Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32427
Trapped Gene
Cercam (ENSMUSG00000039787)
Vector Insertion
Chr 2: 29733657 - 29736132
Public Clones IST13938C2 (tigm) IST12641B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000288163 (Chr2:29733524..29733656 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTCAAACATCTCGGTGTG Chr2:29733541..29733560 59.68 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000288163 (Chr2:29733524..29733656 +)
Downstram Exon
ENSMUSE00000288156 (Chr2:29736133..29736260 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTCAAACATCTCGGTGTG Chr2:29733541..29733560 59.68 50 GCGTACGTCATCCTCAAACA Chr2:29736186..29736205 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000395045 Chr2:29725014..29725245 CACTCTCTGCCCCACTACCT Chr2:29725178..29725197 59.33 60
upstream ENSMUSE00000333193 Chr2:29726543..29726653 CTATGCGACTGTCGTCTGGA Chr2:29726615..29726634 60.01 55
upstream ENSMUSE00000288208 Chr2:29726795..29726912 CCAAAGAACGGCATCAGTTT Chr2:29726830..29726849 60.11 45
upstream ENSMUSE00000288202 Chr2:29728083..29728217 CAACTTTTGGTGTGGGATCA Chr2:29728190..29728209 59.39 45
upstream ENSMUSE00000288193 Chr2:29728328..29728532 CAGTTGGCCTTTTGATGACA Chr2:29728480..29728499 59.69 45
upstream ENSMUSE00000288188 Chr2:29731125..29731244 TGACCATCGTTACGGGTACA Chr2:29731147..29731166 59.84 50
upstream ENSMUSE00000288181 Chr2:29731508..29731584 CCCAAAGAAGCTCAGCAAAA Chr2:29731551..29731570 60.49 45
upstream ENSMUSE00000288171 Chr2:29731681..29731787 ATCTGCCCAGGTGGTAGATG Chr2:29731755..29731774 59.95 55
upstream ENSMUSE00000288163 Chr2:29733524..29733656 TCCTCAAACATCTCGGTGTG Chr2:29733541..29733560 59.68 50

*** Putative Vector Insertion (Chr 2: 29733657 - 29736132) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000288156 Chr2:29736133..29736260 GCGTACGTCATCCTCAAACA Chr2:29736186..29736205 59.72 50
downstream ENSMUSE00000288148 Chr2:29736435..29736638 GTGGCGATCAAACATGACAG Chr2:29736636..29736655 60.12 50
downstream ENSMUSE00000472373 Chr2:29737216..29738360 TTCCACCAACCAGGAAAGAG Chr2:29738277..29738296 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGCTTCCTCAGCCACTAC Chr2:29733623..29733643 60.16 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGCTTCCTCAGCCACTAC Chr2:29733623..29733643 60.16 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039787