Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32432
Trapped Gene
Fgf11 (ENSMUSG00000042826)
Vector Insertion
Chr 11: 69613167 - 69615219
Public Clones IST12074H5 (tigm) IST12011G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000399867 (Chr11:69614935..69615218 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTGCCAGAAACAGCTCCT Chr11:69614997..69615016 59.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000399867 (Chr11:69614935..69615218 -)
Downstram Exon
ENSMUSE00000111738 (Chr11:69613168..69613278 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTGCCAGAAACAGCTCCT Chr11:69614997..69615016 59.62 50 GCAGAACAGTTTGGTGACGA Chr11:69613219..69613238 59.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000399867 Chr11:69614935..69615218 CTTTGCCAGAAACAGCTCCT Chr11:69614997..69615016 59.62 50
upstream ENSMUSE00000662012 Chr11:69614935..69615359 GTGGTGTTGGGGAACGTACT Chr11:69615269..69615288 59.74 55
upstream ENSMUSE00000713964 Chr11:69614935..69615218 CTTTGCCAGAAACAGCTCCT Chr11:69614997..69615016 59.62 50
upstream ENSMUSE00000111738 Chr11:69613168..69613278 TCGTCACCAAACTGTTCTGC Chr11:69613241..69613260 59.88 50

*** Putative Vector Insertion (Chr 11: 69613167 - 69615219) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000111739 Chr11:69612854..69612957 GCCATGTAGTGACCCAGCTT Chr11:69612863..69612882 60.14 55
downstream ENSMUSE00000328361 Chr11:69612066..69612180 GCCTTGGTCTTCTTGACTCG Chr11:69612076..69612095 59.99 55
downstream ENSMUSE00000662011 Chr11:69612066..69612264 GCCTTGGTCTTCTTGACTCG Chr11:69612076..69612095 59.99 55
downstream ENSMUSE00000328357 Chr11:69611667..69611774 AGAGAAGGCTCCCGGTACAT Chr11:69611728..69611747 60.1 55
downstream ENSMUSE00000662010 Chr11:69609575..69611774 AGGCTCCTCGTTTCCTAAGC Chr11:69609939..69609958 59.98 55
downstream ENSMUSE00000578715 Chr11:69609571..69611381 CCAGTGGACCGACCTAGAAA Chr11:69611237..69611256 60.1 55
downstream ENSMUSE00000677439 Chr11:69609570..69611381 CCAGTGGACCGACCTAGAAA Chr11:69611237..69611256 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCTGGGGTTTCTCTTCAG Chr11:69615245..69615265 58.72 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCTGGGGTTTCTCTTCAG Chr11:69615245..69615265 58.72 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042826