Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32440
Trapped Gene
Supt4h1 (ENSMUSG00000020485)
Vector Insertion
Chr 11: 87551171 - 87551668
Public Clones (sanger) IST14187C1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000713994 (Chr11:87551053..87551170 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000713994 (Chr11:87551053..87551170 +)
Downstram Exon
ENSMUSE00000674931 (Chr11:87551669..87551775 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710938 Chr11:87551053..87551170 No primer for this exon
upstream ENSMUSE00000713994 Chr11:87551053..87551170 No primer for this exon

*** Putative Vector Insertion (Chr 11: 87551171 - 87551668) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000586310 Chr11:87551669..87551775 No primer for this exon
downstream ENSMUSE00000674931 Chr11:87551669..87551775 No primer for this exon
downstream ENSMUSE00000674926 Chr11:87554007..87554148 No primer for this exon
downstream ENSMUSE00000674938 Chr11:87556210..87556297 No primer for this exon
downstream ENSMUSE00000105306 Chr11:87556298..87556353 No primer for this exon
downstream ENSMUSE00000586308 Chr11:87556560..87556613 No primer for this exon
downstream ENSMUSE00000705982 Chr11:87556748..87557116 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr11:87551221..87551241 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTGTGCTCGTTAGTCAAGGT Chr11:87551153..87551174 59.56 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020485