Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32446
Trapped Gene
Slc18a1 (ENSMUSG00000036330)
Vector Insertion
Chr 8: 71561606 - 71564274
Public Clones IST10253A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000479945 (Chr8:71564140..71564273 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000479945 (Chr8:71564140..71564273 -)
Downstram Exon
ENSMUSE00000447571 (Chr8:71561607..71562804 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGGCCCAGATATCACCCTCT Chr8:71562648..71562667 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000484837 Chr8:71612880..71613121 CAATCATCAGGAGCCCACTT Chr8:71613019..71613038 60.07 50
upstream ENSMUSE00000484002 Chr8:71601088..71601162 CCTCACATCAAGACGAGCTG Chr8:71601092..71601111 59.57 55
upstream ENSMUSE00000447676 Chr8:71598933..71599204 CCTGGACAATATGCTGCTCA Chr8:71598942..71598961 59.82 50
upstream ENSMUSE00000237797 Chr8:71597455..71597809 GGTACCATCCCTCCTCCAGT Chr8:71597602..71597621 60.19 60
upstream ENSMUSE00000237791 Chr8:71595962..71596020 TCACATCCCCATGTTTGTTG Chr8:71595992..71596011 60.22 45
upstream ENSMUSE00000237872 Chr8:71592043..71592126 GCTTTCTCTGGCACCTATGC Chr8:71592102..71592121 59.99 55
upstream ENSMUSE00000237865 Chr8:71591039..71591131 TGCTGGCCAGTGTCTATACG Chr8:71591103..71591122 59.89 55
upstream ENSMUSE00000582079 Chr8:71589455..71589544 ATGAATTTGTGGGCAAGTCC Chr8:71589498..71589517 59.8 45
upstream ENSMUSE00000237780 Chr8:71589193..71589236 TTTTGCATCCTATGGCCTTC Chr8:71589209..71589228 60.04 45
upstream ENSMUSE00000237846 Chr8:71575352..71575412 GGGGACTCCACTTTTGACAC Chr8:71575385..71575404 59.4 55
upstream ENSMUSE00000582078 Chr8:71575179..71575274 CTGGATGATGCAGACCATGT Chr8:71575200..71575219 59.51 50
upstream ENSMUSE00000447601 Chr8:71567824..71567902 CTCATTGGCACGAACCTTTT Chr8:71567851..71567870 60.11 45
upstream ENSMUSE00000335182 Chr8:71566613..71566664 TCCCTTGTTGGAATGGTAGC Chr8:71566635..71566654 59.93 50
upstream ENSMUSE00000237759 Chr8:71564877..71564940 No primer for this exon
upstream ENSMUSE00000582077 Chr8:71564481..71564600 CATGGGATACCTGGTGGACT Chr8:71564553..71564572 59.65 55
upstream ENSMUSE00000479945 Chr8:71564140..71564273 No primer for this exon
upstream ENSMUSE00000447571 Chr8:71561607..71562804 AGCAGAACAAGGCGTTCATT Chr8:71561842..71561861 59.88 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTCCACAGGCCCATCTAC Chr8:71564262..71564282 59.93 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTTCCACAGGCCCATCTAC Chr8:71564262..71564282 59.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036330