Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32448
Trapped Gene
Pias3 (ENSMUSG00000028101)
Vector Insertion
Chr 3: 96501119 - 96503342
Public Clones (sanger) 5SD086E06 (ggtc) IST14607E7 (tigm) IST14347E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000716198 (Chr3:96501040..96501118 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000716198 (Chr3:96501040..96501118 +)
Downstram Exon
ENSMUSE00000672030 (Chr3:96503343..96503576 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CACTCGGAAACTCATCACCA Chr3:96503369..96503388 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672029 Chr3:96500307..96500454 No primer for this exon
upstream ENSMUSE00000714246 Chr3:96501040..96501118 No primer for this exon
upstream ENSMUSE00000716198 Chr3:96501040..96501118 No primer for this exon

*** Putative Vector Insertion (Chr 3: 96501119 - 96503342) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000471133 Chr3:96503343..96503760 CACTCGGAAACTCATCACCA Chr3:96503369..96503388 59.68 50
downstream ENSMUSE00000483592 Chr3:96503343..96503576 CACTCGGAAACTCATCACCA Chr3:96503369..96503388 59.68 50
downstream ENSMUSE00000672028 Chr3:96503343..96503760 CACTCGGAAACTCATCACCA Chr3:96503369..96503388 59.68 50
downstream ENSMUSE00000672030 Chr3:96503343..96503576 CACTCGGAAACTCATCACCA Chr3:96503369..96503388 59.68 50
downstream ENSMUSE00000486133 Chr3:96503682..96503760 CAGTGGCTTCATGGTGACAT Chr3:96503717..96503736 59.55 50
downstream ENSMUSE00000176100 Chr3:96503916..96504000 CTGGACGTGAGAATCTGCTG Chr3:96504003..96504022 59.57 55
downstream ENSMUSE00000176107 Chr3:96504141..96504191 No primer for this exon
downstream ENSMUSE00000176104 Chr3:96504412..96504502 GGGGGAAATAGTCCTCCTGA Chr3:96504461..96504480 60.26 55
downstream ENSMUSE00000176103 Chr3:96505209..96505343 CAAGGGTGTGATGTTGATCG Chr3:96505283..96505302 59.96 50
downstream ENSMUSE00000176098 Chr3:96505539..96505644 CTCACCAGGTACACGGACAA Chr3:96505570..96505589 59.59 55
downstream ENSMUSE00000176106 Chr3:96506097..96506170 AGTGACACCCGGAGACTTGT Chr3:96506163..96506182 59.6 55
downstream ENSMUSE00000566047 Chr3:96506280..96506440 GTCCATGTCGGCTTCTTCTC Chr3:96506392..96506411 59.81 55
downstream ENSMUSE00000176096 Chr3:96507449..96507582 TCATCACAATCCGAACAGGA Chr3:96507493..96507512 60.05 45
downstream ENSMUSE00000176102 Chr3:96507662..96507830 CTGAATTCCCTCCTGGACTG Chr3:96507699..96507718 59.65 55
downstream ENSMUSE00000176108 Chr3:96507982..96508115 AGCGGGAGACTAGACAGGAA Chr3:96508074..96508093 59.04 55
downstream ENSMUSE00000176095 Chr3:96508272..96508309 No primer for this exon
downstream ENSMUSE00000439152 Chr3:96508772..96509839 GCCTGTTAGGCAGCGATAAG Chr3:96509204..96509223 60 55
downstream ENSMUSE00000705670 Chr3:96508772..96509885 GCCTGTTAGGCAGCGATAAG Chr3:96509204..96509223 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCTGGGCGAGTTAAAGGT Chr3:96501102..96501122 60.76 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTGGGCGAGTTAAAGGT Chr3:96501102..96501122 60.76 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028101