Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32449
Trapped Gene
Arhgap11a (ENSMUSG00000041219)
Vector Insertion
Chr 2: 113685411 - 113688455
Public Clones IST10901H1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000685996 (Chr2:113688118..113688454 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGAGTAGGCGACGTGTTC Chr2:113688250..113688269 59.87 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000685996 (Chr2:113688118..113688454 -)
Downstram Exon
ENSMUSE00000309650 (Chr2:113685412..113685482 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGAGTAGGCGACGTGTTC Chr2:113688250..113688269 59.87 60 CCAAATTCTGGAACGACTGAA Chr2:113685402..113685422 60.1 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000309656 Chr2:113688118..113688813 GGAGAGTAGGCGACGTGTTC Chr2:113688250..113688269 59.87 60
upstream ENSMUSE00000661890 Chr2:113688118..113688818 GGAGAGTAGGCGACGTGTTC Chr2:113688250..113688269 59.87 60
upstream ENSMUSE00000685996 Chr2:113688118..113688454 GGAGAGTAGGCGACGTGTTC Chr2:113688250..113688269 59.87 60
upstream ENSMUSE00000713334 Chr2:113688118..113688813 GGAGAGTAGGCGACGTGTTC Chr2:113688250..113688269 59.87 60
upstream ENSMUSE00000309650 Chr2:113685412..113685482 GCCTCATTCAGTCGTTCCAG Chr2:113685431..113685450 60.8 55

*** Putative Vector Insertion (Chr 2: 113685411 - 113688455) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000309642 Chr2:113683404..113683500 GAACAACAGACCCCGACTTC Chr2:113683399..113683418 59.56 55
downstream ENSMUSE00000309634 Chr2:113682843..113683096 TTGCCATAAGACACGACAGC Chr2:113682879..113682898 59.87 50
downstream ENSMUSE00000309625 Chr2:113682064..113682227 CATGGCCTTCACTTGTCTGA Chr2:113682126..113682145 59.83 50
downstream ENSMUSE00000309615 Chr2:113681754..113681897 GTCTCCTTCAAAGCCTTCCA Chr2:113681781..113681800 59.4 50
downstream ENSMUSE00000309605 Chr2:113680856..113680930 TTTAGGGCTCCATTCACAAA Chr2:113680887..113680906 58.21 40
downstream ENSMUSE00000309598 Chr2:113679832..113679999 CACTCGGGGTGAGAATCAAT Chr2:113679939..113679958 59.93 50
downstream ENSMUSE00000309588 Chr2:113677583..113677709 TCTGAGATGATCCGTCAGGA Chr2:113677652..113677671 59.29 50
downstream ENSMUSE00000309581 Chr2:113677023..113677128 ACGGAGAGATCTTCGGGTCT Chr2:113677034..113677053 60.22 55
downstream ENSMUSE00000309575 Chr2:113674935..113675073 GTCGTCGACCAACATTTTCA Chr2:113675006..113675025 59.55 45
downstream ENSMUSE00000685995 Chr2:113673418..113675073 GTTGCCTCGAAAGTCTCTGG Chr2:113673803..113673822 59.99 55
downstream ENSMUSE00000397525 Chr2:113672998..113674619 GTTGCCTCGAAAGTCTCTGG Chr2:113673803..113673822 59.99 55
downstream ENSMUSE00000685998 Chr2:113672998..113674619 GTTGCCTCGAAAGTCTCTGG Chr2:113673803..113673822 59.99 55
downstream ENSMUSE00000661889 Chr2:113671703..113674619 ACAAGCACCCCGATCTACAC Chr2:113672411..113672430 60 55
downstream ENSMUSE00000685997 Chr2:113671649..113674619 ACAAGCACCCCGATCTACAC Chr2:113672411..113672430 60 55
downstream ENSMUSE00000517679 Chr2:113670173..113672487 ACAAGCACCCCGATCTACAC Chr2:113672411..113672430 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGGCTGGTGGAAGTGAAA Chr2:113688440..113688460 60.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGGCTGGTGGAAGTGAAA Chr2:113688440..113688460 60.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041219