Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32454
Trapped Gene
1500041N16Rik (ENSMUSG00000005150)
Vector Insertion
Chr 8: 87604211 - 87604586
Public Clones IST14435E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000606530 (Chr8:87604412..87604585 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000606530 (Chr8:87604412..87604585 -)
Downstram Exon
ENSMUSE00000415503 (Chr8:87604212..87604332 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000606530 Chr8:87604412..87604585 No primer for this exon
upstream ENSMUSE00000415503 Chr8:87604212..87604332 No primer for this exon

*** Putative Vector Insertion (Chr 8: 87604211 - 87604586) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211876 Chr8:87604019..87604124 No primer for this exon
downstream ENSMUSE00000606529 Chr8:87603977..87604124 No primer for this exon
downstream ENSMUSE00000211882 Chr8:87603688..87603736 No primer for this exon
downstream ENSMUSE00000211881 Chr8:87603480..87603606 No primer for this exon
downstream ENSMUSE00000581278 Chr8:87600116..87600183 No primer for this exon
downstream ENSMUSE00000635488 Chr8:87599923..87600031 No primer for this exon
downstream ENSMUSE00000415478 Chr8:87599722..87599836 No primer for this exon
downstream ENSMUSE00000606528 Chr8:87599059..87599103 No primer for this exon
downstream ENSMUSE00000375200 Chr8:87598936..87599242 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:87604516..87604536 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTGAAAGCTTGGGAGGAC Chr8:87604568..87604588 58.91 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005150