Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32456
Trapped Gene
Epn1 (ENSMUSG00000035203)
Vector Insertion
Chr 7: 5033724 - 5035331
Public Clones IST13360G2 (tigm) IST10827A2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000637463 (Chr7:5033620..5033723 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000637463 (Chr7:5033620..5033723 +)
Downstram Exon
ENSMUSE00000538345 (Chr7:5035332..5035584 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCTCATGATCTCGGAGAAGG Chr7:5035533..5035552 59.91 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637464 Chr7:5031846..5032079 CCCTGGAAGCCCGGTATAAG Chr7:5032051..5032070 62.87 60
upstream ENSMUSE00000637469 Chr7:5031895..5032079 CCCTGGAAGCCCGGTATAAG Chr7:5032051..5032070 62.87 60
upstream ENSMUSE00000637463 Chr7:5033620..5033723 No primer for this exon

*** Putative Vector Insertion (Chr 7: 5033724 - 5035331) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000637462 Chr7:5035265..5035584 GAGAAATGACGCGACTCACA Chr7:5035324..5035343 59.99 50
downstream ENSMUSE00000538345 Chr7:5035332..5035584 GCTCATGATCTCGGAGAAGG Chr7:5035533..5035552 59.91 55
downstream ENSMUSE00000398658 Chr7:5041521..5041770 TCACGGTCCACATACTGGAA Chr7:5041639..5041658 59.96 50
downstream ENSMUSE00000405634 Chr7:5044443..5044567 No primer for this exon
downstream ENSMUSE00000447145 Chr7:5044914..5044988 GCTCCTCTCGGCTCAAACTA Chr7:5044983..5045002 59.72 55
downstream ENSMUSE00000397347 Chr7:5045501..5045584 ATCTGCAGCCTCAGGTCATC Chr7:5045544..5045563 60.38 55
downstream ENSMUSE00000469917 Chr7:5046556..5046859 TGGGGTTGTGAAGACATCAG Chr7:5046597..5046616 59.52 50
downstream ENSMUSE00000399788 Chr7:5047245..5047355 No primer for this exon
downstream ENSMUSE00000677241 Chr7:5047490..5047576 GGAGTCGGTCGAAGTCTGAG Chr7:5047546..5047565 59.99 60
downstream ENSMUSE00000366755 Chr7:5047493..5047576 GGAGTCGGTCGAAGTCTGAG Chr7:5047546..5047565 59.99 60
downstream ENSMUSE00000386280 Chr7:5048756..5049013 ATCCACAAGGGCTGCATTAG Chr7:5048943..5048962 60.1 50
downstream ENSMUSE00000345856 Chr7:5049174..5049780 GACTGAGACGGAGCTGGTTC Chr7:5049263..5049282 59.99 60
downstream ENSMUSE00000637461 Chr7:5049174..5049778 GACTGAGACGGAGCTGGTTC Chr7:5049263..5049282 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr7:5033775..5033795 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000035203