Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32467
Trapped Gene
Serac1 (ENSMUSG00000015659)
Vector Insertion
Chr 17: 6074155 - 6079674
Public Clones IST13202B4 (tigm) IST12300E1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704156 (Chr17:6079619..6079673 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704156 (Chr17:6079619..6079673 -)
Downstram Exon
ENSMUSE00000399030 (Chr17:6074156..6074247 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000358337 Chr17:6079619..6079741 No primer for this exon
upstream ENSMUSE00000704156 Chr17:6079619..6079673 No primer for this exon
upstream ENSMUSE00000399030 Chr17:6074156..6074247 No primer for this exon

*** Putative Vector Insertion (Chr 17: 6074155 - 6079674) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000135485 Chr17:6071834..6071870 No primer for this exon
downstream ENSMUSE00000135484 Chr17:6070753..6070889 No primer for this exon
downstream ENSMUSE00000658476 Chr17:6069299..6069388 No primer for this exon
downstream ENSMUSE00000135480 Chr17:6067529..6067660 No primer for this exon
downstream ENSMUSE00000135495 Chr17:6066671..6066792 No primer for this exon
downstream ENSMUSE00000135494 Chr17:6064949..6065077 No primer for this exon
downstream ENSMUSE00000135478 Chr17:6061548..6061661 No primer for this exon
downstream ENSMUSE00000135487 Chr17:6060203..6060365 No primer for this exon
downstream ENSMUSE00000135473 Chr17:6056607..6056757 No primer for this exon
downstream ENSMUSE00000322327 Chr17:6051690..6051831 No primer for this exon
downstream ENSMUSE00000135489 Chr17:6050725..6050819 No primer for this exon
downstream ENSMUSE00000322318 Chr17:6049963..6050060 No primer for this exon
downstream ENSMUSE00000322315 Chr17:6048831..6049013 No primer for this exon
downstream ENSMUSE00000322311 Chr17:6045645..6045788 No primer for this exon
downstream ENSMUSE00000322307 Chr17:6044066..6044250 No primer for this exon
downstream ENSMUSE00000704148 Chr17:6040718..6042916 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCATGTGTCTAGGAATCTGC Chr17:6076659..6076680 59.71 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAACACTGGGCAGATGCAG Chr17:6076679..6076699 59.32 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015659