Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32469
Trapped Gene
Wnt5b (ENSMUSG00000030170)
Vector Insertion
Chr 6: 119396352 - 119398291
Public Clones IST14024D6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717809 (Chr6:119398154..119398290 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCGCTTTGGAAGATGTTG Chr6:119398267..119398286 60.77 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717809 (Chr6:119398154..119398290 -)
Downstram Exon
ENSMUSE00000196035 (Chr6:119396353..119396600 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCGCTTTGGAAGATGTTG Chr6:119398267..119398286 60.77 50 ACATCTCCGGTCTCTGCACT Chr6:119396541..119396560 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000719380 Chr6:119493999..119494336 No primer for this exon
upstream ENSMUSE00000693030 Chr6:119417117..119417229 AGCTGGGGAGAGACAGTGTG Chr6:119417188..119417207 60.46 60
upstream ENSMUSE00000719939 Chr6:119399235..119399404 GTGGCCCCAGGTTAAACATA Chr6:119399315..119399334 59.69 50
upstream ENSMUSE00000708584 Chr6:119398154..119398290 CTCCGCTTTGGAAGATGTTG Chr6:119398267..119398286 60.77 50
upstream ENSMUSE00000712871 Chr6:119398154..119398290 CTCCGCTTTGGAAGATGTTG Chr6:119398267..119398286 60.77 50
upstream ENSMUSE00000717809 Chr6:119398154..119398290 CTCCGCTTTGGAAGATGTTG Chr6:119398267..119398286 60.77 50
upstream ENSMUSE00000196035 Chr6:119396353..119396600 AGTGCAGAGACCGGAGATGT Chr6:119396563..119396582 59.87 55
upstream ENSMUSE00000716468 Chr6:119396353..119396600 AGTGCAGAGACCGGAGATGT Chr6:119396563..119396582 59.87 55

*** Putative Vector Insertion (Chr 6: 119396352 - 119398291) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000196034 Chr6:119390300..119390592 AGCCGTACTCCACGTTGTCT Chr6:119390394..119390413 59.79 55
downstream ENSMUSE00000373284 Chr6:119382552..119383874 GTCACCGGTTGGAGTGACTT Chr6:119382840..119382859 60.01 55
downstream ENSMUSE00000712340 Chr6:119382551..119383874 GTCACCGGTTGGAGTGACTT Chr6:119382840..119382859 60.01 55
downstream ENSMUSE00000719102 Chr6:119382549..119383874 GTCACCGGTTGGAGTGACTT Chr6:119382840..119382859 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCCTTTGCTCCCCTCTCT Chr6:119398293..119398313 60.47 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCCTTTGCTCCCCTCTCT Chr6:119398293..119398313 60.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030170