Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32478
Trapped Gene
Pkd1l1 (ENSMUSG00000046634)
Vector Insertion
Chr 11: 8757038 - 8761310
Public Clones IST14700E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000488867 (Chr11:8761199..8761309 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCAATCATGCCATCAGGAAA Chr11:8761210..8761229 60.01 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000488867 (Chr11:8761199..8761309 -)
Downstram Exon
ENSMUSE00000477426 (Chr11:8757039..8757159 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCAATCATGCCATCAGGAAA Chr11:8761210..8761229 60.01 40 TCCAGTCCCACCAGTCTTCT Chr11:8757082..8757101 59.68 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581129 Chr11:8872947..8873268 GGCAGGTGCAACTACTGTGA Chr11:8872971..8872990 59.9 55
upstream ENSMUSE00000581128 Chr11:8865052..8865219 CTCAAGGCTGTTGTCCATGA Chr11:8865186..8865205 59.83 50
upstream ENSMUSE00000581127 Chr11:8862597..8862716 CAGTCGTGGTGCATTGTTTT Chr11:8862694..8862713 59.62 45
upstream ENSMUSE00000581126 Chr11:8861929..8862097 GGAGTTCGCTTGGTATTTCG Chr11:8861993..8862012 59.71 50
upstream ENSMUSE00000581125 Chr11:8861260..8861499 TCTCTGAACCCCACCTCATC Chr11:8861436..8861455 60.05 55
upstream ENSMUSE00000581124 Chr11:8858854..8858986 AACCACCCCCAGTGAAGAAC Chr11:8858875..8858894 61.18 55
upstream ENSMUSE00000581123 Chr11:8853865..8854071 CATCATGCTCCCAAGCTACA Chr11:8853900..8853919 59.82 50
upstream ENSMUSE00000581122 Chr11:8850352..8850533 CGTCATCTCTGAAGGCACAC Chr11:8850440..8850459 59.42 55
upstream ENSMUSE00000581121 Chr11:8847148..8847369 TGGCCCTGCTTTGATAACTC Chr11:8847313..8847332 60.21 50
upstream ENSMUSE00000581120 Chr11:8845188..8845348 TCCCAGACCTCACGTATTCC Chr11:8845234..8845253 59.93 55
upstream ENSMUSE00000581119 Chr11:8841905..8842246 TTGGGACCAGTCTGAAGTCC Chr11:8842185..8842204 60.09 55
upstream ENSMUSE00000581118 Chr11:8841044..8841103 TAGCGACATCCAAGAAGCAG Chr11:8841068..8841087 59.17 50
upstream ENSMUSE00000581117 Chr11:8836848..8837024 CCAGTTATGGGGACAACCTG Chr11:8836951..8836970 60.22 55
upstream ENSMUSE00000581116 Chr11:8833643..8833720 TCACTGAGCAGTGGCAAGAC Chr11:8833666..8833685 60.19 55
upstream ENSMUSE00000581115 Chr11:8831552..8831694 GCATGTCTTACTGGGCAAGG Chr11:8831668..8831687 60.66 55
upstream ENSMUSE00000581114 Chr11:8829358..8829478 CCTGTACCGTGGTCAAGACA Chr11:8829409..8829428 59.59 55
upstream ENSMUSE00000581113 Chr11:8816250..8816361 CTGTGCTACCCCGTTACCAT Chr11:8816276..8816295 59.88 55
upstream ENSMUSE00000581112 Chr11:8809804..8810002 ATCCTGAGCCGCTTGTATGT Chr11:8809895..8809914 59.72 50
upstream ENSMUSE00000581111 Chr11:8808672..8808728 No primer for this exon
upstream ENSMUSE00000581110 Chr11:8802412..8802621 CTCCAGGAGGTTGCTAGTCG Chr11:8802537..8802556 60.01 60
upstream ENSMUSE00000581109 Chr11:8801145..8801360 CCAGGTACATTTCCCCAGTG Chr11:8801258..8801277 60.22 55
upstream ENSMUSE00000581108 Chr11:8790660..8790770 TGGAGTTTGGGGAAGAAGACT Chr11:8790665..8790685 60.1 47.62
upstream ENSMUSE00000581107 Chr11:8790391..8790545 AGCCCGTTACAAGACCCTTT Chr11:8790411..8790430 60 50
upstream ENSMUSE00000581106 Chr11:8789030..8789130 CGGGTCTACTTCTGGGATGA Chr11:8789071..8789090 60.06 55
upstream ENSMUSE00000581105 Chr11:8786576..8786768 CCAGGATCGTCTCCTGAAAA Chr11:8786588..8786607 60.19 50
upstream ENSMUSE00000371892 Chr11:8781401..8781484 TCACCTTGCACCTGTCTCTG Chr11:8781459..8781478 60.02 55
upstream ENSMUSE00000373525 Chr11:8779103..8779310 GCTGTATGCAGTCGTCATCG Chr11:8779141..8779160 60.44 55
upstream ENSMUSE00000337982 Chr11:8775655..8775761 TGTGGTGAAAATGGATGCTC Chr11:8775727..8775746 59.5 45
upstream ENSMUSE00000373117 Chr11:8774102..8774318 GGGTGGCCATGTATTACGAG Chr11:8774140..8774159 60.21 55
upstream ENSMUSE00000354314 Chr11:8771707..8771880 ACTGTGCGAGACCATCAACA Chr11:8771708..8771727 60.32 50
upstream ENSMUSE00000402878 Chr11:8770208..8770327 CTGTCCAGTTGCACAGCTTC Chr11:8770234..8770253 59.62 55
upstream ENSMUSE00000362346 Chr11:8770052..8770121 GGGATATGCAGGCTTCAACA Chr11:8770092..8770111 61 50
upstream ENSMUSE00000399659 Chr11:8769461..8769504 GATTCCAGTGGGAGACCAGA Chr11:8769480..8769499 60.05 55
upstream ENSMUSE00000336750 Chr11:8768460..8768616 GTCTGTTCACCGTTCCCAAT Chr11:8768528..8768547 59.83 50
upstream ENSMUSE00000387886 Chr11:8767134..8767269 TGCTCTGGTCAAGCTCTGTG Chr11:8767199..8767218 60.33 55
upstream ENSMUSE00000344862 Chr11:8766095..8766179 TGTGGTGGCTATACCTGCTG Chr11:8766140..8766159 59.74 55
upstream ENSMUSE00000368126 Chr11:8765485..8765661 TTGGAAACGGAAACATGACA Chr11:8765616..8765635 59.94 40
upstream ENSMUSE00000352032 Chr11:8763806..8763924 CACCATCCAAGGCTAAGCTC Chr11:8763859..8763878 59.84 55
upstream ENSMUSE00000488867 Chr11:8761199..8761309 TCAATCATGCCATCAGGAAA Chr11:8761210..8761229 60.01 40
upstream ENSMUSE00000477426 Chr11:8757039..8757159 ACGCTGAGCACACTGCTAGA Chr11:8757085..8757104 59.95 55

*** Putative Vector Insertion (Chr 11: 8757038 - 8761310) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000462946 Chr11:8756263..8756346 GCAGTGCCAGCAGAAATCTT Chr11:8756248..8756267 60.55 50
downstream ENSMUSE00000465514 Chr11:8755566..8755714 CAGGGGACACATTTTGGTTC Chr11:8755605..8755624 60.21 50
downstream ENSMUSE00000466504 Chr11:8754346..8754580 CAGGATCACGCTTGTGAAGA Chr11:8754432..8754451 59.98 50
downstream ENSMUSE00000483403 Chr11:8749658..8749762 GGAAACAGAGGTGGATCACG Chr11:8749701..8749720 60.51 55
downstream ENSMUSE00000581103 Chr11:8748921..8749061 GAACTGGTCGGTGATGTTCA Chr11:8748956..8748975 59.53 50
downstream ENSMUSE00000581102 Chr11:8744544..8744669 CACTGCTGAGAAGGGTGTCA Chr11:8744549..8744568 60.02 55
downstream ENSMUSE00000581101 Chr11:8736206..8736436 CCGTGGTCAGACTTCAAACA Chr11:8736245..8736264 59.72 50
downstream ENSMUSE00000581100 Chr11:8734777..8734935 CCCAGAAGGGTGAGGACTTT Chr11:8734798..8734817 60.48 55
downstream ENSMUSE00000581099 Chr11:8733777..8733947 AACTGCCAACTGGAGGACTG Chr11:8733775..8733794 60.3 55
downstream ENSMUSE00000581098 Chr11:8726728..8726810 CAGCAGCTAAGGGACCAGAT Chr11:8726767..8726786 59.45 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCGCAGAGACATGACCAC Chr11:8761296..8761316 59.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCGCAGAGACATGACCAC Chr11:8761296..8761316 59.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046634