Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32489
Trapped Gene
Gabbr1 (ENSMUSG00000024462)
Vector Insertion
Chr 17: 37207727 - 37208797
Public Clones IST11737G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000142516 (Chr17:37207599..37207726 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTGGGAATCTTTCTTGCT Chr17:37207632..37207651 59.96 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000142516 (Chr17:37207599..37207726 +)
Downstram Exon
ENSMUSE00000142509 (Chr17:37208798..37208926 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTGGGAATCTTTCTTGCT Chr17:37207632..37207651 59.96 45 ATGGTGACAGGAGCGGTAAT Chr17:37208832..37208851 59.43 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696575 Chr17:37183016..37183234 AGCCTGGATTCCTGTGGAAG Chr17:37183105..37183124 61.55 55
upstream ENSMUSE00000543755 Chr17:37183640..37183721 No primer for this exon
upstream ENSMUSE00000448950 Chr17:37184399..37184602 ATCAGGTACCGTGGCTTGAC Chr17:37184434..37184453 60 55
upstream ENSMUSE00000503591 Chr17:37185366..37185551 TCCGAATCTGCTCCAAGTCT Chr17:37185366..37185385 59.95 50
upstream ENSMUSE00000696573 Chr17:37186722..37186742 No primer for this exon
upstream ENSMUSE00000696551 Chr17:37187750..37188104 AGAGACATCCTGCCGGACTA Chr17:37188054..37188073 59.83 55
upstream ENSMUSE00000510627 Chr17:37187944..37188104 AGAGACATCCTGCCGGACTA Chr17:37188054..37188073 59.83 55
upstream ENSMUSE00000142512 Chr17:37191076..37191210 CCCGGATGTGGAACCTTATT Chr17:37191188..37191207 60.93 50
upstream ENSMUSE00000142518 Chr17:37191682..37191852 ACGTTCTTTCGGACACATCC Chr17:37191733..37191752 59.97 50
upstream ENSMUSE00000142524 Chr17:37192791..37192892 GTGAAAGAGGCTGGGATTGA Chr17:37192815..37192834 60.19 50
upstream ENSMUSE00000142505 Chr17:37193241..37193306 CTCGAATCATCGTGGGACTT Chr17:37193251..37193270 60.07 50
upstream ENSMUSE00000142507 Chr17:37193733..37193924 TTCTCATCGGGTGGTATGCT Chr17:37193773..37193792 60.48 50
upstream ENSMUSE00000142508 Chr17:37199479..37199721 CTAACCAAGCGGCTGAAAAG Chr17:37199503..37199522 60.01 50
upstream ENSMUSE00000142525 Chr17:37200275..37200338 GGACGCTTATCGAGCAGCTA Chr17:37200315..37200334 60.65 55
upstream ENSMUSE00000142511 Chr17:37201605..37201682 ACGACAGCACCAAGGATGAT Chr17:37201632..37201651 60.54 50
upstream ENSMUSE00000142515 Chr17:37204159..37204309 TCATCAAGACATTCCGTTTCC Chr17:37204189..37204209 59.92 42.86
upstream ENSMUSE00000142510 Chr17:37204721..37204853 AGCCAGTTCCCATTTGTCTG Chr17:37204830..37204849 60.11 50
upstream ENSMUSE00000142522 Chr17:37206057..37206173 GGTGGGTCCACACAGTCTTC Chr17:37206121..37206140 60.42 60
upstream ENSMUSE00000142517 Chr17:37206258..37206365 TTGGAAACTGTACGCCACTG Chr17:37206269..37206288 59.76 50
upstream ENSMUSE00000142521 Chr17:37206926..37207019 ACTTTTGCCAAGGAGGAACC Chr17:37206926..37206945 60.48 50
upstream ENSMUSE00000696549 Chr17:37207165..37207193 GCTTTGGTCTTTTTGCTGTGA Chr17:37207169..37207189 60.41 42.86
upstream ENSMUSE00000142516 Chr17:37207599..37207726 TGCTGGGAATCTTTCTTGCT Chr17:37207632..37207651 59.96 45

*** Putative Vector Insertion (Chr 17: 37207727 - 37208797) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000142509 Chr17:37208798..37208926 ATGGTGACAGGAGCGGTAAT Chr17:37208832..37208851 59.43 50
downstream ENSMUSE00000142514 Chr17:37209089..37209232 TTTCCAATTCACGGTTTTCC Chr17:37209221..37209240 59.78 40
downstream ENSMUSE00000468594 Chr17:37209798..37210377 TAAGAGGGGGATTGGAGCTT Chr17:37210075..37210094 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:37207777..37207797 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCGGTAAGCTTTCTTGACAC Chr17:37207724..37207745 60.43 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024462