Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3249
Trapped Gene
Pdcd11 (ENSMUSG00000025047)
Vector Insertion
Chr 19: 47171507 - 47172610
Public Clones AK0417 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000542374 (Chr19:47171345..47171506 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTTCTCCCCTGGAATGTTG Chr19:47171367..47171386 60.04 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000542374 (Chr19:47171345..47171506 +)
Downstram Exon
ENSMUSE00000542373 (Chr19:47172611..47172734 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTTCTCCCCTGGAATGTTG Chr19:47171367..47171386 60.04 50 TTTGTTCTTCTGCCGGATGT Chr19:47172736..47172755 60.64 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000505829 Chr19:47165258..47165357 AGCCCTGGTCTTACCTACGC Chr19:47165267..47165286 60.65 60
upstream ENSMUSE00000542377 Chr19:47167272..47167390 CACGGAAACTCCACAAATCA Chr19:47167326..47167345 59.54 45
upstream ENSMUSE00000542376 Chr19:47168241..47168372 CCACAGAAGAAGGTCCCATT Chr19:47168245..47168264 58.99 50
upstream ENSMUSE00000542375 Chr19:47169698..47169865 TTGTGCAAGTGACCGAAGTC Chr19:47169789..47169808 59.88 50
upstream ENSMUSE00000542374 Chr19:47171345..47171506 TCTTCTCCCCTGGAATGTTG Chr19:47171367..47171386 60.04 50

*** Putative Vector Insertion (Chr 19: 47171507 - 47172610) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000542373 Chr19:47172611..47172734 TTTGTTCTTCTGCCGGATGT Chr19:47172736..47172755 60.64 45
downstream ENSMUSE00000542372 Chr19:47173181..47173362 CAACTCCTCCGTTGCTTTTC Chr19:47173252..47173271 59.85 50
downstream ENSMUSE00000542371 Chr19:47175553..47175660 CAGGCCCTTGAAGAACGTAA Chr19:47175606..47175625 60.24 50
downstream ENSMUSE00000542369 Chr19:47177057..47177263 CATCTAGCACAGCCCCTAGC Chr19:47177189..47177208 60 60
downstream ENSMUSE00000706643 Chr19:47177256..47177263 No primer for this exon
downstream ENSMUSE00000494983 Chr19:47178242..47178366 No primer for this exon
downstream ENSMUSE00000507836 Chr19:47178242..47178278 No primer for this exon
downstream ENSMUSE00000508701 Chr19:47178284..47178366 No primer for this exon
downstream ENSMUSE00000617979 Chr19:47178523..47178583 No primer for this exon
downstream ENSMUSE00000617978 Chr19:47179146..47179292 ATCCCCTGGGCTGTACTTCT Chr19:47179280..47179299 59.96 55
downstream ENSMUSE00000617977 Chr19:47180787..47181038 ATGATAACACCGTGCGTCTG Chr19:47180920..47180939 59.6 50
downstream ENSMUSE00000617976 Chr19:47181501..47181641 AGCACTGCCACCTTTACCAC Chr19:47181523..47181542 60.18 55
downstream ENSMUSE00000617975 Chr19:47182044..47182238 CAGAACTCGGTGAAGGGTGT Chr19:47182214..47182233 60.15 55
downstream ENSMUSE00000617974 Chr19:47182913..47183083 GACGAACACGCCATACTCCT Chr19:47183047..47183066 60.14 55
downstream ENSMUSE00000617973 Chr19:47184044..47184263 TCTGCTTCGATTCATCCACA Chr19:47184143..47184162 60.35 45
downstream ENSMUSE00000617972 Chr19:47185451..47185600 GGTGGTATCTGCTGGCTCTC Chr19:47185597..47185616 59.83 60
downstream ENSMUSE00000617971 Chr19:47186528..47186643 GTCCACGTGTAGAACCACGA Chr19:47186583..47186602 59.6 55
downstream ENSMUSE00000617970 Chr19:47187631..47188205 GCTGTACGATTCCCTGGTGT Chr19:47187670..47187689 60 55
downstream ENSMUSE00000689151 Chr19:47189045..47189107 TGGGGTGACTTATTGGGAGA Chr19:47189070..47189089 60.31 50
downstream ENSMUSE00000542290 Chr19:47191787..47191808 No primer for this exon
downstream ENSMUSE00000542346 Chr19:47191787..47191892 CGGGGCTCTCAGAGTGAGTA Chr19:47191839..47191858 60.54 60
downstream ENSMUSE00000542345 Chr19:47194026..47194115 GTCCGATGTCCACTTCAAGC Chr19:47194068..47194087 60.67 55
downstream ENSMUSE00000542344 Chr19:47194283..47194385 CCCAACCTGGAACTTCTTGT Chr19:47194321..47194340 59.04 50
downstream ENSMUSE00000542343 Chr19:47194737..47194914 AAGGGAAGGAGACGGTCAGT Chr19:47194826..47194845 60.11 55
downstream ENSMUSE00000542342 Chr19:47198921..47198977 GATGACCGGAGTGACAAAGC Chr19:47198977..47198996 60.67 55
downstream ENSMUSE00000542341 Chr19:47199535..47199657 TCACGTCCTCAATGGAGTTG Chr19:47199599..47199618 59.68 50
downstream ENSMUSE00000542340 Chr19:47200796..47200918 TACTTGGCCAAACCCAGAAC Chr19:47200831..47200850 59.97 50
downstream ENSMUSE00000542339 Chr19:47201365..47201599 CTGCTCGCTCTCAGACTCCT Chr19:47201602..47201621 60.03 60
downstream ENSMUSE00000542338 Chr19:47201741..47201857 TTCCACACCACTGTCGTCTT Chr19:47201806..47201825 59.15 50
downstream ENSMUSE00000542337 Chr19:47202436..47202582 CCTCGCTGTCTGAGCTCTCT Chr19:47202562..47202581 60.03 60
downstream ENSMUSE00000542334 Chr19:47202765..47203012 CATGTACTGCAGCCAAAGGA Chr19:47202938..47202957 59.86 50
downstream ENSMUSE00000542333 Chr19:47203632..47203800 ACCCACACGTTCAGCTTCTC Chr19:47203664..47203683 60.31 55
downstream ENSMUSE00000542332 Chr19:47204119..47204272 ATCCGGTTGTACAGCTCACC Chr19:47204147..47204166 60 55
downstream ENSMUSE00000542331 Chr19:47204438..47204603 GGGGTAGGTGCTCAGTGTGT Chr19:47204538..47204557 60.03 60
downstream ENSMUSE00000472385 Chr19:47205129..47205640 AGTCCAGGTAGCGCTTGAAA Chr19:47205208..47205227 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGCCTGGCATGGTAAGTA Chr19:47171495..47171515 60.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGCCTGGCATGGTAAGTA Chr19:47171495..47171515 60.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025047