Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32502
Trapped Gene
Ntn2l (ENSMUSG00000079662)
Vector Insertion
Chr 17: 24340792 - 24344228
Public Clones IST14408D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000138492 (Chr17:24344153..24344227 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTCTGCCGGAAGGACTATG Chr17:24344153..24344172 59.69 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000138492 (Chr17:24344153..24344227 -)
Downstram Exon
ENSMUSE00000464718 (Chr17:24340793..24343892 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTCTGCCGGAAGGACTATG Chr17:24344153..24344172 59.69 55 TTAGGAGCAATGCTGTGTGC Chr17:24340847..24340866 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000138488 Chr17:24345004..24346332 GCCTCGCTCTTGTATTCCTG Chr17:24345805..24345824 59.98 55
upstream ENSMUSE00000138490 Chr17:24344744..24344932 GGGCTTCTATCGTGATCCAG Chr17:24344777..24344796 59.65 55
upstream ENSMUSE00000520748 Chr17:24344511..24344660 ATGGTGTTACTGGCCTCACC Chr17:24344569..24344588 59.85 55
upstream ENSMUSE00000138487 Chr17:24344338..24344388 CGAAGAAAGCAGTCCTGTGG Chr17:24344347..24344366 60.96 55
upstream ENSMUSE00000138492 Chr17:24344153..24344227 GTTCTGCCGGAAGGACTATG Chr17:24344153..24344172 59.69 55
upstream ENSMUSE00000464718 Chr17:24340793..24343892 CAGCCGTCGGAGTTCTAGTC Chr17:24342703..24342722 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGGCATGGGAATCTGCTA Chr17:24341247..24341267 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGGCATGGGAATCTGCTA Chr17:24341247..24341267 59.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079662