Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32503
Trapped Gene
Etnk2 (ENSMUSG00000070644)
Vector Insertion
Chr 1: 135275100 - 135275893
Public Clones IST12290E6 (tigm) IST12290E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691056 (Chr1:135275026..135275099 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGGCACTCATACAGAACCA Chr1:135275050..135275069 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691056 (Chr1:135275026..135275099 +)
Downstram Exon
ENSMUSE00000691054 (Chr1:135275894..135276892 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGGCACTCATACAGAACCA Chr1:135275050..135275069 60.11 50 CTGGTACCCAAGGTCATGCT Chr1:135276618..135276637 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000596617 Chr1:135260411..135260595 No primer for this exon
upstream ENSMUSE00000659338 Chr1:135262153..135262412 ACGGGCTGTGCTACGAGTAT Chr1:135262340..135262359 59.79 55
upstream ENSMUSE00000659337 Chr1:135265327..135265449 TCGTTATTTCACGCTGGTCA Chr1:135265411..135265430 60.26 45
upstream ENSMUSE00000596614 Chr1:135269712..135269892 GATTCCCCTGTGGTGTTCTG Chr1:135269788..135269807 60.36 55
upstream ENSMUSE00000659336 Chr1:135269712..135269854 GATTCCCCTGTGGTGTTCTG Chr1:135269788..135269807 60.36 55
upstream ENSMUSE00000659335 Chr1:135271104..135271187 TACCAGGCATTTGACATTGG Chr1:135271145..135271164 59.4 45
upstream ENSMUSE00000691059 Chr1:135273483..135273628 TTATCTTGAGGCGCAGAAGG Chr1:135273547..135273566 60.48 50
upstream ENSMUSE00000691056 Chr1:135275026..135275099 TGGGCACTCATACAGAACCA Chr1:135275050..135275069 60.11 50

*** Putative Vector Insertion (Chr 1: 135275100 - 135275893) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000691054 Chr1:135275894..135276892 CTGGTACCCAAGGTCATGCT Chr1:135276618..135276637 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGAGTAATCGCCTTGCAG Chr1:135275145..135275165 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAGCGTGACTGGGAAAAC Chr1:135275146..135275166 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070644