Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32507
Trapped Gene
A130090K04Rik (ENSMUSG00000064065)
Vector Insertion
Chr 10: 3434999 - 3445777
Public Clones IST13040H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000645103 (Chr10:3434583..3434998 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCGTGTGTTACCCTGCTCA Chr10:3434806..3434825 60.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000645103 (Chr10:3434583..3434998 +)
Downstram Exon
ENSMUSE00000323581 (Chr10:3445778..3445971 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCGTGTGTTACCCTGCTCA Chr10:3434806..3434825 60.3 50 TGCATCGCTTCACAAAAGAC Chr10:3445915..3445934 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000645108 Chr10:3294060..3294084 No primer for this exon
upstream ENSMUSE00000645107 Chr10:3323356..3323399 TCAGCAGCAGTAGACCTGGA Chr10:3323357..3323376 59.73 55
upstream ENSMUSE00000645105 Chr10:3349965..3350011 TTATGGCCACAGAAGGCAAT Chr10:3349992..3350011 60.47 45
upstream ENSMUSE00000645102 Chr10:3366076..3366294 TAGAATCCACCCCGCTCATA Chr10:3366146..3366165 60.43 50
upstream ENSMUSE00000666881 Chr10:3366165..3366294 TCAGAAGCCCAGGAAGAAAA Chr10:3366269..3366288 59.93 45
upstream ENSMUSE00000616800 Chr10:3366830..3367027 AAGGGCTCATCGCTGTATTG Chr10:3366992..3367011 60.24 50
upstream ENSMUSE00000645101 Chr10:3366858..3367027 AAGGGCTCATCGCTGTATTG Chr10:3366992..3367011 60.24 50
upstream ENSMUSE00000666880 Chr10:3366858..3367027 AAGGGCTCATCGCTGTATTG Chr10:3366992..3367011 60.24 50
upstream ENSMUSE00000616799 Chr10:3390409..3390482 TGGAAAGAGCCTCTGAATGC Chr10:3390452..3390471 60.48 50
upstream ENSMUSE00000616798 Chr10:3391800..3391871 CCCACAGATCAAAGCCTTCT Chr10:3391818..3391837 59.28 50
upstream ENSMUSE00000616797 Chr10:3409382..3409440 CACCAGGAATCCATCACAAA Chr10:3409413..3409432 59.34 45
upstream ENSMUSE00000616796 Chr10:3411266..3411366 TACAGTGAGAGCGAGCAGGA Chr10:3411271..3411290 59.88 55
upstream ENSMUSE00000645104 Chr10:3411266..3411354 TACAGTGAGAGCGAGCAGGA Chr10:3411271..3411290 59.88 55
upstream ENSMUSE00000489071 Chr10:3426455..3426827 TCACATTTGCTGAGCAGGTC Chr10:3426633..3426652 59.99 50
upstream ENSMUSE00000645100 Chr10:3426455..3428987 TCACATTTGCTGAGCAGGTC Chr10:3426633..3426652 59.99 50
upstream ENSMUSE00000645103 Chr10:3434583..3434998 TTCGTGTGTTACCCTGCTCA Chr10:3434806..3434825 60.3 50

*** Putative Vector Insertion (Chr 10: 3434999 - 3445777) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000323581 Chr10:3445778..3445971 TGCATCGCTTCACAAAAGAC Chr10:3445915..3445934 59.99 45
downstream ENSMUSE00000616795 Chr10:3455866..3456102 AGCCAAATCGTGTTCTTTGC Chr10:3455889..3455908 60.26 45
downstream ENSMUSE00000666879 Chr10:3455866..3460745 CAGGACAGTTCGCATCTCAA Chr10:3459788..3459807 59.98 50
downstream ENSMUSE00000666882 Chr10:3455866..3460176 CAGGACAGTTCGCATCTCAA Chr10:3459788..3459807 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTTTTTCCCCCACCACAG Chr10:3440954..3440974 61.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTCTGCACAAAATGGAAA Chr10:3441010..3441030 60.87 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064065