Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32541
Trapped Gene
Ttn (ENSMUSG00000051747)
Vector Insertion
Chr 2: 76641349 - 76645261
Public Clones (sanger) IST12641G6 (tigm) IST12946D3 (tigm) IST10860H2 (tigm) IST11008D11 (tigm)
IST12657D12 (tigm) IST13126A9 (tigm) IST15089G10 (tigm) IST11863A3 (tigm)
IST10817F11 (tigm) IST10815A11 (tigm) IST10606A9 (tigm) IST11168G2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000601453 (Chr2:76645118..76645260 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000601453 (Chr2:76645118..76645260 -)
Downstram Exon
ENSMUSE00000644300 (Chr2:76641350..76641473 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000418798 Chr2:76820395..76820604 No primer for this exon
upstream ENSMUSE00000689428 Chr2:76820395..76820512 No primer for this exon
upstream ENSMUSE00000405588 Chr2:76818149..76818252 No primer for this exon
upstream ENSMUSE00000708711 Chr2:76818149..76818252 No primer for this exon
upstream ENSMUSE00000327638 Chr2:76815150..76815353 No primer for this exon
upstream ENSMUSE00000327633 Chr2:76812968..76813255 No primer for this exon
upstream ENSMUSE00000327110 Chr2:76812408..76812493 No primer for this exon
upstream ENSMUSE00000327101 Chr2:76812073..76812314 No primer for this exon
upstream ENSMUSE00000327095 Chr2:76807678..76808008 No primer for this exon
upstream ENSMUSE00000342745 Chr2:76807197..76807349 No primer for this exon
upstream ENSMUSE00000327729 Chr2:76806453..76806590 No primer for this exon
upstream ENSMUSE00000327721 Chr2:76805111..76805242 No primer for this exon
upstream ENSMUSE00000327714 Chr2:76803834..76803971 No primer for this exon
upstream ENSMUSE00000327799 Chr2:76803148..76803285 No primer for this exon
upstream ENSMUSE00000689759 Chr2:76802532..76802669 No primer for this exon
upstream ENSMUSE00000689758 Chr2:76792852..76793145 No primer for this exon
upstream ENSMUSE00000689757 Chr2:76792643..76792765 No primer for this exon
upstream ENSMUSE00000689756 Chr2:76791058..76791345 No primer for this exon
upstream ENSMUSE00000689755 Chr2:76790827..76790892 No primer for this exon
upstream ENSMUSE00000689754 Chr2:76789977..76790235 No primer for this exon
upstream ENSMUSE00000689753 Chr2:76789704..76789764 No primer for this exon
upstream ENSMUSE00000689751 Chr2:76789372..76789587 No primer for this exon
upstream ENSMUSE00000689748 Chr2:76788072..76788214 No primer for this exon
upstream ENSMUSE00000689747 Chr2:76786995..76787200 No primer for this exon
upstream ENSMUSE00000689746 Chr2:76786244..76786477 No primer for this exon
upstream ENSMUSE00000689745 Chr2:76785885..76786129 No primer for this exon
upstream ENSMUSE00000689742 Chr2:76784754..76785037 No primer for this exon
upstream ENSMUSE00000689741 Chr2:76784449..76784613 No primer for this exon
upstream ENSMUSE00000689740 Chr2:76784174..76784342 No primer for this exon
upstream ENSMUSE00000689739 Chr2:76782366..76784059 No primer for this exon
upstream ENSMUSE00000689738 Chr2:76781948..76782229 No primer for this exon
upstream ENSMUSE00000689737 Chr2:76781258..76781524 No primer for this exon
upstream ENSMUSE00000689736 Chr2:76780904..76781176 No primer for this exon
upstream ENSMUSE00000689735 Chr2:76780233..76780496 No primer for this exon
upstream ENSMUSE00000689734 Chr2:76779879..76780139 No primer for this exon
upstream ENSMUSE00000689732 Chr2:76777907..76778167 No primer for this exon
upstream ENSMUSE00000689731 Chr2:76777101..76777364 No primer for this exon
upstream ENSMUSE00000689730 Chr2:76776751..76777011 No primer for this exon
upstream ENSMUSE00000689729 Chr2:76776364..76776624 No primer for this exon
upstream ENSMUSE00000689728 Chr2:76775630..76775890 No primer for this exon
upstream ENSMUSE00000689727 Chr2:76774692..76774833 No primer for this exon
upstream ENSMUSE00000689726 Chr2:76774439..76774604 No primer for this exon
upstream ENSMUSE00000689725 Chr2:76772196..76772427 No primer for this exon
upstream ENSMUSE00000689724 Chr2:76770503..76770787 No primer for this exon
upstream ENSMUSE00000689266 Chr2:76770189..76770285 No primer for this exon
upstream ENSMUSE00000689723 Chr2:76770189..76770314 No primer for this exon
upstream ENSMUSE00000689722 Chr2:76765144..76765332 No primer for this exon
upstream ENSMUSE00000689720 Chr2:76759608..76759664 No primer for this exon
upstream ENSMUSE00000644291 Chr2:76752234..76758520 No primer for this exon
upstream ENSMUSE00000689427 Chr2:76745365..76748010 No primer for this exon
upstream ENSMUSE00000689719 Chr2:76744311..76744589 No primer for this exon
upstream ENSMUSE00000689718 Chr2:76741120..76741683 No primer for this exon
upstream ENSMUSE00000689716 Chr2:76739898..76740179 No primer for this exon
upstream ENSMUSE00000689715 Chr2:76739521..76739799 No primer for this exon
upstream ENSMUSE00000689714 Chr2:76738814..76739092 No primer for this exon
upstream ENSMUSE00000689713 Chr2:76738439..76738717 No primer for this exon
upstream ENSMUSE00000689712 Chr2:76738037..76738324 No primer for this exon
upstream ENSMUSE00000689711 Chr2:76737648..76737926 No primer for this exon
upstream ENSMUSE00000689709 Chr2:76737265..76737546 No primer for this exon
upstream ENSMUSE00000689707 Chr2:76736895..76737173 No primer for this exon
upstream ENSMUSE00000689705 Chr2:76736502..76736780 No primer for this exon
upstream ENSMUSE00000689704 Chr2:76736120..76736398 No primer for this exon
upstream ENSMUSE00000689703 Chr2:76735572..76735859 No primer for this exon
upstream ENSMUSE00000689702 Chr2:76735179..76735457 No primer for this exon
upstream ENSMUSE00000689701 Chr2:76734756..76735037 No primer for this exon
upstream ENSMUSE00000689700 Chr2:76734377..76734655 No primer for this exon
upstream ENSMUSE00000689699 Chr2:76733981..76734259 No primer for this exon
upstream ENSMUSE00000689697 Chr2:76733590..76733868 No primer for this exon
upstream ENSMUSE00000689696 Chr2:76733199..76733486 No primer for this exon
upstream ENSMUSE00000689695 Chr2:76732717..76732959 No primer for this exon
upstream ENSMUSE00000689426 Chr2:76732681..76732959 No primer for this exon
upstream ENSMUSE00000689693 Chr2:76732199..76732480 No primer for this exon
upstream ENSMUSE00000689691 Chr2:76730956..76731234 No primer for this exon
upstream ENSMUSE00000689690 Chr2:76730561..76730842 No primer for this exon
upstream ENSMUSE00000689688 Chr2:76729369..76729647 No primer for this exon
upstream ENSMUSE00000689686 Chr2:76728964..76729251 No primer for this exon
upstream ENSMUSE00000689685 Chr2:76728522..76728800 No primer for this exon
upstream ENSMUSE00000689683 Chr2:76728151..76728429 No primer for this exon
upstream ENSMUSE00000689227 Chr2:76727766..76727982 No primer for this exon
upstream ENSMUSE00000689681 Chr2:76727766..76728044 No primer for this exon
upstream ENSMUSE00000689679 Chr2:76727361..76727648 No primer for this exon
upstream ENSMUSE00000689678 Chr2:76726943..76727230 No primer for this exon
upstream ENSMUSE00000689675 Chr2:76725863..76726144 No primer for this exon
upstream ENSMUSE00000689673 Chr2:76725164..76725442 No primer for this exon
upstream ENSMUSE00000689672 Chr2:76724782..76725063 No primer for this exon
upstream ENSMUSE00000689671 Chr2:76724365..76724643 No primer for this exon
upstream ENSMUSE00000689669 Chr2:76723985..76724272 No primer for this exon
upstream ENSMUSE00000689668 Chr2:76723554..76723832 No primer for this exon
upstream ENSMUSE00000689667 Chr2:76723182..76723460 No primer for this exon
upstream ENSMUSE00000689666 Chr2:76722809..76723087 No primer for this exon
upstream ENSMUSE00000689665 Chr2:76722403..76722690 No primer for this exon
upstream ENSMUSE00000689664 Chr2:76721967..76722254 No primer for this exon
upstream ENSMUSE00000689663 Chr2:76719615..76719896 No primer for this exon
upstream ENSMUSE00000689660 Chr2:76719121..76719399 No primer for this exon
upstream ENSMUSE00000689659 Chr2:76718432..76718713 No primer for this exon
upstream ENSMUSE00000689657 Chr2:76718040..76718318 No primer for this exon
upstream ENSMUSE00000689656 Chr2:76717115..76717402 No primer for this exon
upstream ENSMUSE00000689655 Chr2:76716731..76717009 No primer for this exon
upstream ENSMUSE00000689654 Chr2:76716325..76716603 No primer for this exon
upstream ENSMUSE00000689653 Chr2:76715960..76716238 No primer for this exon
upstream ENSMUSE00000689652 Chr2:76714939..76715226 No primer for this exon
upstream ENSMUSE00000689651 Chr2:76714509..76714796 No primer for this exon
upstream ENSMUSE00000689650 Chr2:76713748..76714038 No primer for this exon
upstream ENSMUSE00000689649 Chr2:76711768..76712055 No primer for this exon
upstream ENSMUSE00000689648 Chr2:76711124..76711216 No primer for this exon
upstream ENSMUSE00000689647 Chr2:76710738..76711023 No primer for this exon
upstream ENSMUSE00000689646 Chr2:76709762..76709945 No primer for this exon
upstream ENSMUSE00000689645 Chr2:76709133..76709222 No primer for this exon
upstream ENSMUSE00000689644 Chr2:76708767..76709034 No primer for this exon
upstream ENSMUSE00000689216 Chr2:76708408..76708668 No primer for this exon
upstream ENSMUSE00000689643 Chr2:76708408..76708668 No primer for this exon
upstream ENSMUSE00000689642 Chr2:76706344..76706553 No primer for this exon
upstream ENSMUSE00000689641 Chr2:76706065..76706142 No primer for this exon
upstream ENSMUSE00000689640 Chr2:76705940..76705966 No primer for this exon
upstream ENSMUSE00000689639 Chr2:76705479..76705538 No primer for this exon
upstream ENSMUSE00000689638 Chr2:76705215..76705298 No primer for this exon
upstream ENSMUSE00000689637 Chr2:76703280..76703354 No primer for this exon
upstream ENSMUSE00000689425 Chr2:76702329..76702373 No primer for this exon
upstream ENSMUSE00000689636 Chr2:76702329..76702382 No primer for this exon
upstream ENSMUSE00000689635 Chr2:76701331..76701732 No primer for this exon
upstream ENSMUSE00000689634 Chr2:76700857..76700916 No primer for this exon
upstream ENSMUSE00000689633 Chr2:76700407..76700484 No primer for this exon
upstream ENSMUSE00000689632 Chr2:76700169..76700246 No primer for this exon
upstream ENSMUSE00000689631 Chr2:76699480..76699566 No primer for this exon
upstream ENSMUSE00000689630 Chr2:76699154..76699234 No primer for this exon
upstream ENSMUSE00000689225 Chr2:76697972..76698054 No primer for this exon
upstream ENSMUSE00000689629 Chr2:76697971..76698054 No primer for this exon
upstream ENSMUSE00000689628 Chr2:76697517..76697603 No primer for this exon
upstream ENSMUSE00000689627 Chr2:76695961..76696044 No primer for this exon
upstream ENSMUSE00000689626 Chr2:76695667..76695747 No primer for this exon
upstream ENSMUSE00000689625 Chr2:76695454..76695531 No primer for this exon
upstream ENSMUSE00000689624 Chr2:76695212..76695286 No primer for this exon
upstream ENSMUSE00000689623 Chr2:76694860..76694961 No primer for this exon
upstream ENSMUSE00000689622 Chr2:76694322..76694423 No primer for this exon
upstream ENSMUSE00000689621 Chr2:76692444..76692524 No primer for this exon
upstream ENSMUSE00000689620 Chr2:76692207..76692275 No primer for this exon
upstream ENSMUSE00000689619 Chr2:76691908..76691985 No primer for this exon
upstream ENSMUSE00000689618 Chr2:76691662..76691745 No primer for this exon
upstream ENSMUSE00000689617 Chr2:76691212..76691295 No primer for this exon
upstream ENSMUSE00000689616 Chr2:76690891..76690974 No primer for this exon
upstream ENSMUSE00000689615 Chr2:76690114..76690194 No primer for this exon
upstream ENSMUSE00000689613 Chr2:76689612..76689821 No primer for this exon
upstream ENSMUSE00000689612 Chr2:76688627..76688701 No primer for this exon
upstream ENSMUSE00000689610 Chr2:76688363..76688437 No primer for this exon
upstream ENSMUSE00000689609 Chr2:76688052..76688144 No primer for this exon
upstream ENSMUSE00000689608 Chr2:76687314..76687391 No primer for this exon
upstream ENSMUSE00000689424 Chr2:76686874..76687128 No primer for this exon
upstream ENSMUSE00000689607 Chr2:76686874..76687227 No primer for this exon
upstream ENSMUSE00000689606 Chr2:76686616..76686699 No primer for this exon
upstream ENSMUSE00000689288 Chr2:76686336..76686417 No primer for this exon
upstream ENSMUSE00000689605 Chr2:76686336..76686413 No primer for this exon
upstream ENSMUSE00000689224 Chr2:76685782..76685866 No primer for this exon
upstream ENSMUSE00000689604 Chr2:76685782..76685865 No primer for this exon
upstream ENSMUSE00000689602 Chr2:76685445..76685528 No primer for this exon
upstream ENSMUSE00000689601 Chr2:76685170..76685253 No primer for this exon
upstream ENSMUSE00000689600 Chr2:76684683..76684973 No primer for this exon
upstream ENSMUSE00000689423 Chr2:76684293..76684370 No primer for this exon
upstream ENSMUSE00000689599 Chr2:76683079..76683153 No primer for this exon
upstream ENSMUSE00000689598 Chr2:76682262..76682336 No primer for this exon
upstream ENSMUSE00000689597 Chr2:76681433..76681549 No primer for this exon
upstream ENSMUSE00000689596 Chr2:76680828..76680905 No primer for this exon
upstream ENSMUSE00000689593 Chr2:76679825..76679893 No primer for this exon
upstream ENSMUSE00000689422 Chr2:76679591..76679662 No primer for this exon
upstream ENSMUSE00000689590 Chr2:76679591..76679683 No primer for this exon
upstream ENSMUSE00000644320 Chr2:76679147..76679212 No primer for this exon
upstream ENSMUSE00000689587 Chr2:76679147..76679446 No primer for this exon
upstream ENSMUSE00000644319 Chr2:76678290..76678370 No primer for this exon
upstream ENSMUSE00000689212 Chr2:76678290..76678370 No primer for this exon
upstream ENSMUSE00000689579 Chr2:76677462..76677539 No primer for this exon
upstream ENSMUSE00000689421 Chr2:76676869..76676952 No primer for this exon
upstream ENSMUSE00000689420 Chr2:76676626..76676700 No primer for this exon
upstream ENSMUSE00000644295 Chr2:76674790..76674870 No primer for this exon
upstream ENSMUSE00000644294 Chr2:76674596..76674679 No primer for this exon
upstream ENSMUSE00000644293 Chr2:76674392..76674475 No primer for this exon
upstream ENSMUSE00000644292 Chr2:76673994..76674071 No primer for this exon
upstream ENSMUSE00000689419 Chr2:76672870..76672953 No primer for this exon
upstream ENSMUSE00000689418 Chr2:76671892..76671978 No primer for this exon
upstream ENSMUSE00000689417 Chr2:76671698..76671775 No primer for this exon
upstream ENSMUSE00000689416 Chr2:76671280..76671363 No primer for this exon
upstream ENSMUSE00000689415 Chr2:76671087..76671170 No primer for this exon
upstream ENSMUSE00000689414 Chr2:76670907..76670990 No primer for this exon
upstream ENSMUSE00000689413 Chr2:76670713..76670796 No primer for this exon
upstream ENSMUSE00000689575 Chr2:76670713..76670778 No primer for this exon
upstream ENSMUSE00000689574 Chr2:76670520..76670603 No primer for this exon
upstream ENSMUSE00000689412 Chr2:76670325..76670408 No primer for this exon
upstream ENSMUSE00000644317 Chr2:76670158..76670241 No primer for this exon
upstream ENSMUSE00000689211 Chr2:76670158..76670241 No primer for this exon
upstream ENSMUSE00000644316 Chr2:76669845..76669931 No primer for this exon
upstream ENSMUSE00000689210 Chr2:76669845..76669931 No primer for this exon
upstream ENSMUSE00000689411 Chr2:76669417..76669500 No primer for this exon
upstream ENSMUSE00000689410 Chr2:76669224..76669304 No primer for this exon
upstream ENSMUSE00000689409 Chr2:76669033..76669113 No primer for this exon
upstream ENSMUSE00000689408 Chr2:76668841..76668906 No primer for this exon
upstream ENSMUSE00000689407 Chr2:76668649..76668729 No primer for this exon
upstream ENSMUSE00000689406 Chr2:76668466..76668537 No primer for this exon
upstream ENSMUSE00000689405 Chr2:76668273..76668353 No primer for this exon
upstream ENSMUSE00000689404 Chr2:76668082..76668162 No primer for this exon
upstream ENSMUSE00000689403 Chr2:76667901..76667966 No primer for this exon
upstream ENSMUSE00000689402 Chr2:76667711..76667794 No primer for this exon
upstream ENSMUSE00000689401 Chr2:76667304..76667387 No primer for this exon
upstream ENSMUSE00000689400 Chr2:76667124..76667207 No primer for this exon
upstream ENSMUSE00000689573 Chr2:76666930..76667013 No primer for this exon
upstream ENSMUSE00000689571 Chr2:76666737..76666820 No primer for this exon
upstream ENSMUSE00000689399 Chr2:76666543..76666626 No primer for this exon
upstream ENSMUSE00000689568 Chr2:76666376..76666459 No primer for this exon
upstream ENSMUSE00000689565 Chr2:76666158..76666244 No primer for this exon
upstream ENSMUSE00000689562 Chr2:76665942..76666025 No primer for this exon
upstream ENSMUSE00000689559 Chr2:76665749..76665823 No primer for this exon
upstream ENSMUSE00000689556 Chr2:76665540..76665617 No primer for this exon
upstream ENSMUSE00000644315 Chr2:76665052..76665135 No primer for this exon
upstream ENSMUSE00000689209 Chr2:76665052..76665135 No primer for this exon
upstream ENSMUSE00000644314 Chr2:76664504..76664599 No primer for this exon
upstream ENSMUSE00000689206 Chr2:76664504..76664599 No primer for this exon
upstream ENSMUSE00000644313 Chr2:76664132..76664209 No primer for this exon
upstream ENSMUSE00000689398 Chr2:76663856..76663933 No primer for this exon
upstream ENSMUSE00000689397 Chr2:76663564..76663647 No primer for this exon
upstream ENSMUSE00000689396 Chr2:76662282..76662365 No primer for this exon
upstream ENSMUSE00000689395 Chr2:76661989..76662069 No primer for this exon
upstream ENSMUSE00000689394 Chr2:76660955..76661029 No primer for this exon
upstream ENSMUSE00000644312 Chr2:76660508..76660621 No primer for this exon
upstream ENSMUSE00000710818 Chr2:76659173..76659241 No primer for this exon
upstream ENSMUSE00000722266 Chr2:76659173..76659241 No primer for this exon
upstream ENSMUSE00000644310 Chr2:76656793..76656873 No primer for this exon
upstream ENSMUSE00000689205 Chr2:76656793..76656873 No primer for this exon
upstream ENSMUSE00000644309 Chr2:76655846..76655920 No primer for this exon
upstream ENSMUSE00000689204 Chr2:76655846..76655920 No primer for this exon
upstream ENSMUSE00000644308 Chr2:76655046..76655132 No primer for this exon
upstream ENSMUSE00000689202 Chr2:76655046..76655132 No primer for this exon
upstream ENSMUSE00000644307 Chr2:76654600..76654662 No primer for this exon
upstream ENSMUSE00000689200 Chr2:76654600..76654662 No primer for this exon
upstream ENSMUSE00000644305 Chr2:76654216..76654305 No primer for this exon
upstream ENSMUSE00000689199 Chr2:76654216..76654305 No primer for this exon
upstream ENSMUSE00000644304 Chr2:76653585..76653632 No primer for this exon
upstream ENSMUSE00000689198 Chr2:76653585..76653632 No primer for this exon
upstream ENSMUSE00000689214 Chr2:76652834..76652976 No primer for this exon
upstream ENSMUSE00000689215 Chr2:76652816..76652976 No primer for this exon
upstream ENSMUSE00000644336 Chr2:76652575..76652976 No primer for this exon
upstream ENSMUSE00000709438 Chr2:76652575..76652976 No primer for this exon
upstream ENSMUSE00000720807 Chr2:76652575..76652976 No primer for this exon
upstream ENSMUSE00000689221 Chr2:76652195..76652473 No primer for this exon
upstream ENSMUSE00000709899 Chr2:76652195..76652473 No primer for this exon
upstream ENSMUSE00000709908 Chr2:76652195..76652473 No primer for this exon
upstream ENSMUSE00000601466 Chr2:76651393..76651668 No primer for this exon
upstream ENSMUSE00000689263 Chr2:76651393..76651668 No primer for this exon
upstream ENSMUSE00000601465 Chr2:76650944..76651083 No primer for this exon
upstream ENSMUSE00000689262 Chr2:76650944..76651083 No primer for this exon
upstream ENSMUSE00000601464 Chr2:76650534..76650660 No primer for this exon
upstream ENSMUSE00000689261 Chr2:76650534..76650660 No primer for this exon
upstream ENSMUSE00000601463 Chr2:76650169..76650432 No primer for this exon
upstream ENSMUSE00000689260 Chr2:76650169..76650432 No primer for this exon
upstream ENSMUSE00000601462 Chr2:76649580..76649846 No primer for this exon
upstream ENSMUSE00000689259 Chr2:76649580..76649846 No primer for this exon
upstream ENSMUSE00000601461 Chr2:76649199..76649462 No primer for this exon
upstream ENSMUSE00000689258 Chr2:76649199..76649462 No primer for this exon
upstream ENSMUSE00000601460 Chr2:76648969..76649108 No primer for this exon
upstream ENSMUSE00000689254 Chr2:76648969..76649108 No primer for this exon
upstream ENSMUSE00000601459 Chr2:76648705..76648831 No primer for this exon
upstream ENSMUSE00000689253 Chr2:76648705..76648831 No primer for this exon
upstream ENSMUSE00000601458 Chr2:76648317..76648583 No primer for this exon
upstream ENSMUSE00000689252 Chr2:76648317..76648583 No primer for this exon
upstream ENSMUSE00000601457 Chr2:76647910..76648176 No primer for this exon
upstream ENSMUSE00000689250 Chr2:76647910..76648176 No primer for this exon
upstream ENSMUSE00000601456 Chr2:76646808..76647074 No primer for this exon
upstream ENSMUSE00000689248 Chr2:76646808..76647074 No primer for this exon
upstream ENSMUSE00000601455 Chr2:76646577..76646716 No primer for this exon
upstream ENSMUSE00000689246 Chr2:76646577..76646716 No primer for this exon
upstream ENSMUSE00000601454 Chr2:76646048..76646174 No primer for this exon
upstream ENSMUSE00000689242 Chr2:76646048..76646174 No primer for this exon
upstream ENSMUSE00000601453 Chr2:76645118..76645260 No primer for this exon
upstream ENSMUSE00000644302 Chr2:76645118..76645260 No primer for this exon
upstream ENSMUSE00000644300 Chr2:76641350..76641473 No primer for this exon
upstream ENSMUSE00000689240 Chr2:76641350..76641473 No primer for this exon

*** Putative Vector Insertion (Chr 2: 76641349 - 76645261) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000601452 Chr2:76640288..76640554 No primer for this exon
downstream ENSMUSE00000644298 Chr2:76640288..76640554 No primer for this exon
downstream ENSMUSE00000644296 Chr2:76638594..76638637 No primer for this exon
downstream ENSMUSE00000689482 Chr2:76638540..76638637 No primer for this exon
downstream ENSMUSE00000601450 Chr2:76637497..76637665 No primer for this exon
downstream ENSMUSE00000601449 Chr2:76637141..76637407 No primer for this exon
downstream ENSMUSE00000601448 Chr2:76636771..76637037 No primer for this exon
downstream ENSMUSE00000601447 Chr2:76636408..76636686 No primer for this exon
downstream ENSMUSE00000601446 Chr2:76635905..76636313 No primer for this exon
downstream ENSMUSE00000601445 Chr2:76635670..76635794 No primer for this exon
downstream ENSMUSE00000601444 Chr2:76635296..76635562 No primer for this exon
downstream ENSMUSE00000601443 Chr2:76634327..76634596 No primer for this exon
downstream ENSMUSE00000601442 Chr2:76633935..76634237 No primer for this exon
downstream ENSMUSE00000601441 Chr2:76633536..76633838 No primer for this exon
downstream ENSMUSE00000601440 Chr2:76633112..76633299 No primer for this exon
downstream ENSMUSE00000601439 Chr2:76632856..76632970 No primer for this exon
downstream ENSMUSE00000601438 Chr2:76632467..76632751 No primer for this exon
downstream ENSMUSE00000601437 Chr2:76632209..76632360 No primer for this exon
downstream ENSMUSE00000601436 Chr2:76631166..76631313 No primer for this exon
downstream ENSMUSE00000601435 Chr2:76630848..76631025 No primer for this exon
downstream ENSMUSE00000601434 Chr2:76629921..76630042 No primer for this exon
downstream ENSMUSE00000601433 Chr2:76629543..76629830 No primer for this exon
downstream ENSMUSE00000601432 Chr2:76629144..76629440 No primer for this exon
downstream ENSMUSE00000601431 Chr2:76628853..76629039 No primer for this exon
downstream ENSMUSE00000601430 Chr2:76628326..76628441 No primer for this exon
downstream ENSMUSE00000601429 Chr2:76627936..76628235 No primer for this exon
downstream ENSMUSE00000601428 Chr2:76627469..76627768 No primer for this exon
downstream ENSMUSE00000601427 Chr2:76627271..76627376 No primer for this exon
downstream ENSMUSE00000601426 Chr2:76626960..76627156 No primer for this exon
downstream ENSMUSE00000601425 Chr2:76626571..76626876 No primer for this exon
downstream ENSMUSE00000601424 Chr2:76626197..76626475 No primer for this exon
downstream ENSMUSE00000601423 Chr2:76625084..76625383 No primer for this exon
downstream ENSMUSE00000601422 Chr2:76624674..76624976 No primer for this exon
downstream ENSMUSE00000601421 Chr2:76624200..76624562 No primer for this exon
downstream ENSMUSE00000601420 Chr2:76623587..76623889 No primer for this exon
downstream ENSMUSE00000601419 Chr2:76623159..76623458 No primer for this exon
downstream ENSMUSE00000601418 Chr2:76622765..76623061 No primer for this exon
downstream ENSMUSE00000601417 Chr2:76622378..76622662 No primer for this exon
downstream ENSMUSE00000689318 Chr2:76622378..76622665 No primer for this exon
downstream ENSMUSE00000601416 Chr2:76621981..76622274 No primer for this exon
downstream ENSMUSE00000601415 Chr2:76620247..76620546 No primer for this exon
downstream ENSMUSE00000601414 Chr2:76619846..76620154 No primer for this exon
downstream ENSMUSE00000601413 Chr2:76619570..76619760 No primer for this exon
downstream ENSMUSE00000601412 Chr2:76618770..76619199 No primer for this exon
downstream ENSMUSE00000601411 Chr2:76617335..76617643 No primer for this exon
downstream ENSMUSE00000601410 Chr2:76617063..76617211 No primer for this exon
downstream ENSMUSE00000601409 Chr2:76616946..76616978 No primer for this exon
downstream ENSMUSE00000601408 Chr2:76616722..76616851 No primer for this exon
downstream ENSMUSE00000601407 Chr2:76616333..76616632 No primer for this exon
downstream ENSMUSE00000601406 Chr2:76615922..76616239 No primer for this exon
downstream ENSMUSE00000601405 Chr2:76614725..76615021 No primer for this exon
downstream ENSMUSE00000601404 Chr2:76614312..76614611 No primer for this exon
downstream ENSMUSE00000601403 Chr2:76613896..76614210 No primer for this exon
downstream ENSMUSE00000601402 Chr2:76613648..76613796 No primer for this exon
downstream ENSMUSE00000601401 Chr2:76612811..76612961 No primer for this exon
downstream ENSMUSE00000601400 Chr2:76612439..76612720 No primer for this exon
downstream ENSMUSE00000601399 Chr2:76610424..76610726 No primer for this exon
downstream ENSMUSE00000601398 Chr2:76609561..76609863 No primer for this exon
downstream ENSMUSE00000601397 Chr2:76609181..76609462 No primer for this exon
downstream ENSMUSE00000601396 Chr2:76608790..76609089 No primer for this exon
downstream ENSMUSE00000601395 Chr2:76608396..76608698 No primer for this exon
downstream ENSMUSE00000601394 Chr2:76607995..76608303 No primer for this exon
downstream ENSMUSE00000601393 Chr2:76607597..76607878 No primer for this exon
downstream ENSMUSE00000601392 Chr2:76607214..76607513 No primer for this exon
downstream ENSMUSE00000601391 Chr2:76606838..76607131 No primer for this exon
downstream ENSMUSE00000601390 Chr2:76603775..76606741 No primer for this exon
downstream ENSMUSE00000601389 Chr2:76602691..76603011 No primer for this exon
downstream ENSMUSE00000601388 Chr2:76602302..76602586 No primer for this exon
downstream ENSMUSE00000601387 Chr2:76601904..76602203 No primer for this exon
downstream ENSMUSE00000601386 Chr2:76601293..76601595 No primer for this exon
downstream ENSMUSE00000601385 Chr2:76600627..76600902 No primer for this exon
downstream ENSMUSE00000601384 Chr2:76600209..76600508 No primer for this exon
downstream ENSMUSE00000601383 Chr2:76599711..76600013 No primer for this exon
downstream ENSMUSE00000601382 Chr2:76599143..76599442 No primer for this exon
downstream ENSMUSE00000601381 Chr2:76597895..76598182 No primer for this exon
downstream ENSMUSE00000601380 Chr2:76597143..76597439 No primer for this exon
downstream ENSMUSE00000601379 Chr2:76596749..76597051 No primer for this exon
downstream ENSMUSE00000601378 Chr2:76596349..76596654 No primer for this exon
downstream ENSMUSE00000601377 Chr2:76595085..76595372 No primer for this exon
downstream ENSMUSE00000601376 Chr2:76594698..76594988 No primer for this exon
downstream ENSMUSE00000601375 Chr2:76594324..76594611 No primer for this exon
downstream ENSMUSE00000601374 Chr2:76593556..76594143 No primer for this exon
downstream ENSMUSE00000601373 Chr2:76593356..76593460 No primer for this exon
downstream ENSMUSE00000601372 Chr2:76592815..76593012 No primer for this exon
downstream ENSMUSE00000601371 Chr2:76592423..76592719 No primer for this exon
downstream ENSMUSE00000601370 Chr2:76591745..76592332 No primer for this exon
downstream ENSMUSE00000601369 Chr2:76591341..76591643 No primer for this exon
downstream ENSMUSE00000601368 Chr2:76574121..76591226 No primer for this exon
downstream ENSMUSE00000601367 Chr2:76573283..76573579 No primer for this exon
downstream ENSMUSE00000601366 Chr2:76572570..76573157 No primer for this exon
downstream ENSMUSE00000601365 Chr2:76572177..76572479 No primer for this exon
downstream ENSMUSE00000601364 Chr2:76571775..76572071 No primer for this exon
downstream ENSMUSE00000601363 Chr2:76570409..76570696 No primer for this exon
downstream ENSMUSE00000601362 Chr2:76570000..76570299 No primer for this exon
downstream ENSMUSE00000601361 Chr2:76569452..76569754 No primer for this exon
downstream ENSMUSE00000601360 Chr2:76569052..76569357 No primer for this exon
downstream ENSMUSE00000601359 Chr2:76567180..76568946 No primer for this exon
downstream ENSMUSE00000601358 Chr2:76566366..76566659 No primer for this exon
downstream ENSMUSE00000601357 Chr2:76565403..76565690 No primer for this exon
downstream ENSMUSE00000601356 Chr2:76564991..76565290 No primer for this exon
downstream ENSMUSE00000601355 Chr2:76562835..76564901 No primer for this exon
downstream ENSMUSE00000601354 Chr2:76562431..76562733 No primer for this exon
downstream ENSMUSE00000601353 Chr2:76562036..76562341 No primer for this exon
downstream ENSMUSE00000601352 Chr2:76561633..76561923 No primer for this exon
downstream ENSMUSE00000601351 Chr2:76561250..76561546 No primer for this exon
downstream ENSMUSE00000601350 Chr2:76560816..76561121 No primer for this exon
downstream ENSMUSE00000601349 Chr2:76559658..76559963 No primer for this exon
downstream ENSMUSE00000601348 Chr2:76559291..76559572 No primer for this exon
downstream ENSMUSE00000601347 Chr2:76558537..76559130 No primer for this exon
downstream ENSMUSE00000601346 Chr2:76558139..76558426 No primer for this exon
downstream ENSMUSE00000601345 Chr2:76557738..76558037 No primer for this exon
downstream ENSMUSE00000420861 Chr2:76556931..76557233 No primer for this exon
downstream ENSMUSE00000420262 Chr2:76556352..76556654 No primer for this exon
downstream ENSMUSE00000420255 Chr2:76555668..76556252 No primer for this exon
downstream ENSMUSE00000420248 Chr2:76555230..76555535 No primer for this exon
downstream ENSMUSE00000420245 Chr2:76554806..76555105 No primer for this exon
downstream ENSMUSE00000712317 Chr2:76553597..76554172 No primer for this exon
downstream ENSMUSE00000721335 Chr2:76553597..76554172 No primer for this exon
downstream ENSMUSE00000420237 Chr2:76553201..76553506 No primer for this exon
downstream ENSMUSE00000689445 Chr2:76553201..76553506 No primer for this exon
downstream ENSMUSE00000420233 Chr2:76552386..76552979 No primer for this exon
downstream ENSMUSE00000689444 Chr2:76552386..76552979 No primer for this exon
downstream ENSMUSE00000420268 Chr2:76551689..76552269 No primer for this exon
downstream ENSMUSE00000689393 Chr2:76546833..76552269 No primer for this exon
downstream ENSMUSE00000689317 Chr2:76546811..76552269 No primer for this exon
downstream ENSMUSE00000689443 Chr2:76546811..76552269 No primer for this exon
downstream ENSMUSE00000420897 Chr2:76546505..76546624 No primer for this exon
downstream ENSMUSE00000689316 Chr2:76546505..76546654 No primer for this exon
downstream ENSMUSE00000689392 Chr2:76546505..76546676 No primer for this exon
downstream ENSMUSE00000689442 Chr2:76546505..76546654 No primer for this exon
downstream ENSMUSE00000420894 Chr2:76546216..76546372 No primer for this exon
downstream ENSMUSE00000689441 Chr2:76546216..76546372 No primer for this exon
downstream ENSMUSE00000372372 Chr2:76544754..76545445 No primer for this exon
downstream ENSMUSE00000718156 Chr2:76544754..76545445 No primer for this exon
downstream ENSMUSE00000720875 Chr2:76544754..76545445 No primer for this exon
downstream ENSMUSE00000165524 Chr2:76544497..76544650 No primer for this exon
downstream ENSMUSE00000689314 Chr2:76544497..76544650 No primer for this exon
downstream ENSMUSE00000165519 Chr2:76543727..76544029 No primer for this exon
downstream ENSMUSE00000689313 Chr2:76543727..76544029 No primer for this exon
downstream ENSMUSE00000472988 Chr2:76542077..76543386 No primer for this exon
downstream ENSMUSE00000566110 Chr2:76542041..76543386 No primer for this exon
downstream ENSMUSE00000689312 Chr2:76542041..76543386 No primer for this exon
downstream ENSMUSE00000689391 Chr2:76542037..76543386 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTAATTGGTCTGCTGAGG Chr2:76642236..76642256 59.55 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGTAATTGGTCTGCTGAGG Chr2:76642236..76642256 59.55 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051747