Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32545
Trapped Gene
Kcnip1 (ENSMUSG00000053519)
Vector Insertion
Chr 11: 33743129 - 33892837
Public Clones IST11057G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000654487 (Chr11:33892749..33892836 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGACTCGGGTTCGTGAAAT Chr11:33892794..33892813 60.11 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000654487 (Chr11:33892749..33892836 -)
Downstram Exon
ENSMUSE00000710287 (Chr11:33743130..33743585 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGACTCGGGTTCGTGAAAT Chr11:33892794..33892813 60.11 50 GTGGATTGCCCACTTTGAAT Chr11:33743239..33743258 59.8 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000654487 Chr11:33892749..33892836 CAGACTCGGGTTCGTGAAAT Chr11:33892794..33892813 60.11 50
upstream ENSMUSE00000580336 Chr11:33743130..33743461 CAAACAAAGGCGACCCTCTA Chr11:33743133..33743152 60.24 50
upstream ENSMUSE00000654489 Chr11:33743130..33743585 CAAACAAAGGCGACCCTCTA Chr11:33743133..33743152 60.24 50
upstream ENSMUSE00000710287 Chr11:33743130..33743585 CAAACAAAGGCGACCCTCTA Chr11:33743133..33743152 60.24 50

*** Putative Vector Insertion (Chr 11: 33743129 - 33892837) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000428618 Chr11:33551540..33551572 GGTAATACCACCAGGCGATG Chr11:33551530..33551549 60.21 55
downstream ENSMUSE00000580338 Chr11:33545503..33545627 TTGGTGAAGTTCGTCTGTGC Chr11:33545518..33545537 59.88 50
downstream ENSMUSE00000679968 Chr11:33545503..33545815 TTGGTGAAGTTCGTCTGTGC Chr11:33545518..33545537 59.88 50
downstream ENSMUSE00000428614 Chr11:33544499..33544568 CTCCGTGAGGGAAAAACTGA Chr11:33544477..33544496 60.22 50
downstream ENSMUSE00000428607 Chr11:33543296..33543366 GTCGAAGGCATTGAAGAGGT Chr11:33543304..33543323 59.29 50
downstream ENSMUSE00000428604 Chr11:33542431..33542538 TTCATGGACTGTCCCTCTCA Chr11:33542469..33542488 59.18 50
downstream ENSMUSE00000428600 Chr11:33534579..33534683 TGTCCTCTTTGAGCACAGGA Chr11:33534589..33534608 59.54 50
downstream ENSMUSE00000428595 Chr11:33533148..33533210 TCATCTAACGTTACAATGCCATC Chr11:33533148..33533170 59.03 39.13
downstream ENSMUSE00000592654 Chr11:33530551..33530598 No primer for this exon
downstream ENSMUSE00000654488 Chr11:33529790..33530598 GAGGCAGTGAGTTGGGGATA Chr11:33530216..33530235 60.07 55
downstream ENSMUSE00000654490 Chr11:33529339..33530598 GGGTGGACTAACCACCCTTT Chr11:33529693..33529712 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCACTGGTCTGCCTGCTCT Chr11:33784829..33784849 60.76 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTTGGCGTGACTGGGAAA Chr11:33784773..33784793 62.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053519