Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32555
Trapped Gene
Polh (ENSMUSG00000023953)
Vector Insertion
Chr 17: 46308304 - 46312270
Public Clones IST13167C5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000498467 (Chr17:46312100..46312269 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGCTATGACGCTCACAAGA Chr17:46312161..46312180 60.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000498467 (Chr17:46312100..46312269 -)
Downstram Exon
ENSMUSE00000410035 (Chr17:46308305..46310045 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGCTATGACGCTCACAAGA Chr17:46312161..46312180 60.71 50 AACTTGGTAGCGCAGAGGAA Chr17:46309982..46310001 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000515197 Chr17:46339346..46339544 GGGAGCCTAGGGCTACCTAC Chr17:46339474..46339493 59.22 65
upstream ENSMUSE00000136615 Chr17:46336341..46336483 No primer for this exon
upstream ENSMUSE00000136618 Chr17:46335583..46335717 CTGGCACAAGTTCGTGAGTC Chr17:46335607..46335626 59.47 55
upstream ENSMUSE00000136621 Chr17:46331151..46331365 CCGGGAAGCTAGTGTTGAAG Chr17:46331343..46331362 59.87 55
upstream ENSMUSE00000136614 Chr17:46327556..46327725 ACTGTGGGAGCCATGATTGT Chr17:46327626..46327645 60.4 50
upstream ENSMUSE00000136616 Chr17:46324976..46325079 CTCTTCAGCCAGATGCCAAT Chr17:46324985..46325004 60.36 50
upstream ENSMUSE00000136620 Chr17:46321639..46321758 AGGAAAGCTAGGGGCTTCTG Chr17:46321727..46321746 59.98 55
upstream ENSMUSE00000136619 Chr17:46319634..46319757 CTTGGCTGTATGCCATGTGT Chr17:46319736..46319755 59.6 50
upstream ENSMUSE00000342635 Chr17:46318415..46318480 ACAGTGGTGGCTTTTGCAGT Chr17:46318459..46318478 60.75 50
upstream ENSMUSE00000498467 Chr17:46312100..46312269 TCGCTATGACGCTCACAAGA Chr17:46312161..46312180 60.71 50
upstream ENSMUSE00000410035 Chr17:46308305..46310045 TTCCTCTGCGCTACCAAGTT Chr17:46310004..46310023 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCTCAACCCTTCTCTCTC Chr17:46309273..46309293 60.34 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCCTCAACCCTTCTCTCTC Chr17:46309273..46309293 60.34 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023953