Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32580
Trapped Gene
Qrsl1 (ENSMUSG00000019863)
Vector Insertion
Chr 10: 43604748 - 43608943
Public Clones IST10554B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000098652 (Chr10:43608775..43608942 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000098652 (Chr10:43608775..43608942 -)
Downstram Exon
ENSMUSE00000098651 (Chr10:43604749..43604924 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000363681 Chr10:43621420..43621486 No primer for this exon
upstream ENSMUSE00000098662 Chr10:43615815..43615974 No primer for this exon
upstream ENSMUSE00000098658 Chr10:43615240..43615338 No primer for this exon
upstream ENSMUSE00000098668 Chr10:43614321..43614417 No primer for this exon
upstream ENSMUSE00000098652 Chr10:43608775..43608942 No primer for this exon
upstream ENSMUSE00000098651 Chr10:43604749..43604924 No primer for this exon

*** Putative Vector Insertion (Chr 10: 43604748 - 43608943) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000098660 Chr10:43604555..43604667 No primer for this exon
downstream ENSMUSE00000098661 Chr10:43601872..43602064 No primer for this exon
downstream ENSMUSE00000098665 Chr10:43601279..43601396 No primer for this exon
downstream ENSMUSE00000098657 Chr10:43596278..43596483 No primer for this exon
downstream ENSMUSE00000098654 Chr10:43593996..43594512 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTGAAACAGGCATTCACC Chr10:43605918..43605938 59.14 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTGAAACAGGCATTCACC Chr10:43605918..43605938 59.14 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019863