Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32602
Trapped Gene
Odz2 (ENSMUSG00000049336)
Vector Insertion
Chr 11: 35862593 - 35865525
Public Clones (sanger) IST11061C10 (tigm) IST10833A9 (tigm) IST10867F1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000518039 (Chr11:35865292..35865524 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCGAATCTACCGAGTCAAG Chr11:35865428..35865447 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000518039 (Chr11:35865292..35865524 -)
Downstram Exon
ENSMUSE00000580250 (Chr11:35862594..35862748 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCGAATCTACCGAGTCAAG Chr11:35865428..35865447 59.84 55 TGCTCGAGTCACAGCTCAGT Chr11:35862586..35862605 59.92 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662655 Chr11:37049339..37049384 AGCTACTGACCGAGCTGCTG Chr11:37049339..37049358 60.9 60
upstream ENSMUSE00000662654 Chr11:36959030..36959142 AGTGAGCACTCCCAGAAACG Chr11:36959064..36959083 60.44 55
upstream ENSMUSE00000486747 Chr11:36757443..36757668 CCTACAGTTCCAGCGAGACC Chr11:36757534..36757553 59.87 60
upstream ENSMUSE00000662653 Chr11:36757443..36757743 CCTACAGTTCCAGCGAGACC Chr11:36757534..36757553 59.87 60
upstream ENSMUSE00000471702 Chr11:36678170..36678445 GTGGGGACGAGGGATAAAAT Chr11:36678260..36678279 60.02 50
upstream ENSMUSE00000465844 Chr11:36198621..36198830 GGAATTCTCCCCCAATTCAT Chr11:36198666..36198685 59.96 45
upstream ENSMUSE00000467584 Chr11:36113698..36113932 CACCACAGCCAGTCAACACT Chr11:36113902..36113921 59.78 55
upstream ENSMUSE00000460721 Chr11:36086733..36086971 TCTTCTCCGGGATACCCTTT Chr11:36086903..36086922 59.9 50
upstream ENSMUSE00000461716 Chr11:36034910..36035032 GGCTTACCAGGAAACGATGA Chr11:36034939..36034958 60.07 50
upstream ENSMUSE00000463485 Chr11:36020407..36020612 ACAGTGGCGAAGCAGAAGTT Chr11:36020563..36020582 60.06 50
upstream ENSMUSE00000476921 Chr11:35984828..35985023 TACAATGACGGCAAGGACAA Chr11:35984860..35984879 60.11 45
upstream ENSMUSE00000352097 Chr11:35977221..35977322 GAATGCGTGTCTGGACTGTG Chr11:35977262..35977281 60.32 55
upstream ENSMUSE00000102334 Chr11:35960517..35960711 GCAGCGGAAATGGACAGTAT Chr11:35960674..35960693 60.1 50
upstream ENSMUSE00000102352 Chr11:35954985..35955185 TTGCTTGGATCCTACCTGCT Chr11:35955162..35955181 59.84 50
upstream ENSMUSE00000102360 Chr11:35953078..35953263 GAGCACGGGACCTGTAAAGA Chr11:35953128..35953147 60.26 55
upstream ENSMUSE00000662652 Chr11:35953078..35953260 GAGCACGGGACCTGTAAAGA Chr11:35953128..35953147 60.26 55
upstream ENSMUSE00000580252 Chr11:35920221..35920367 GGTAACGGGAGATGCACACT Chr11:35920325..35920344 60 55
upstream ENSMUSE00000267908 Chr11:35891862..35892072 TTGGACATCATTCAGCAAGG Chr11:35891967..35891986 59.65 45
upstream ENSMUSE00000484911 Chr11:35886232..35886351 CCGAGGCCAAGTAGTAACCA Chr11:35886317..35886336 60.12 55
upstream ENSMUSE00000580251 Chr11:35882866..35883127 GGCCAGATCCAATCATCATC Chr11:35882932..35882951 60.25 50
upstream ENSMUSE00000486643 Chr11:35881820..35882087 AGGGTTCACTTGATGGTTGC Chr11:35881939..35881958 59.97 50
upstream ENSMUSE00000480051 Chr11:35877279..35877422 CAAACACCACACCCTCAATG Chr11:35877288..35877307 59.85 50
upstream ENSMUSE00000480942 Chr11:35876591..35876840 TTCCCTCTCGAAATGTGACC Chr11:35876608..35876627 60.05 50
upstream ENSMUSE00000493139 Chr11:35868428..35868448 No primer for this exon
upstream ENSMUSE00000518039 Chr11:35865292..35865524 GCCGAATCTACCGAGTCAAG Chr11:35865428..35865447 59.84 55
upstream ENSMUSE00000580250 Chr11:35862594..35862748 GTGGACCAAAACGGAATCAT Chr11:35862670..35862689 59.65 45

*** Putative Vector Insertion (Chr 11: 35862593 - 35865525) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000521237 Chr11:35860269..35861143 TCTCGTCCGTCTCAGTGATG Chr11:35860869..35860888 59.98 55
downstream ENSMUSE00000514494 Chr11:35855011..35855186 CCGGTTGGAGTTCTCAATGT Chr11:35855053..35855072 59.97 50
downstream ENSMUSE00000515485 Chr11:35853209..35853444 TGGTAGCTGTTTCGCACTTG Chr11:35853401..35853420 60.05 50
downstream ENSMUSE00000500895 Chr11:35840647..35840943 TTCTCCGTTCGGATATTTCG Chr11:35840866..35840885 60.03 45
downstream ENSMUSE00000501935 Chr11:35836806..35838420 CTTGCCGGAAATCTCATCAT Chr11:35837841..35837860 60.04 45
downstream ENSMUSE00000494973 Chr11:35823877..35824007 TCGCTTGCTTGACTCTCTGA Chr11:35823865..35823884 60.01 50
downstream ENSMUSE00000715455 Chr11:35821537..35822298 ATGGTGGTTCCTAGCGTGAC Chr11:35821927..35821946 60 55
downstream ENSMUSE00000717546 Chr11:35821537..35822298 ATGGTGGTTCCTAGCGTGAC Chr11:35821927..35821946 60 55
downstream ENSMUSE00000662651 Chr11:35820158..35822298 ATGGTGGTTCCTAGCGTGAC Chr11:35821927..35821946 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAAAGCAACAGCCCAGGAC Chr11:35865509..35865529 59.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAAAGCAACAGCCCAGGAC Chr11:35865509..35865529 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049336