Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32606
Trapped Gene
Cd84 (ENSMUSG00000038147)
Vector Insertion
Chr 1: 173782267 - 173802827
Public Clones (ggtc) IST11559B4 (tigm) IST12526G6 (tigm) IST12251A9 (tigm) IST12077E7 (tigm)
IST12453E12 (tigm) IST10950E9 (tigm) IST12098C8 (tigm) IST11929F8 (tigm)
IST10245G7 (tigm) IST10801G12 (tigm) IST12069B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000297626 (Chr1:173781934..173782266 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGGGATTCTTGGGGAGTC Chr1:173781975..173781994 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000297626 (Chr1:173781934..173782266 +)
Downstram Exon
ENSMUSE00000297618 (Chr1:173802828..173803079 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGGGATTCTTGGGGAGTC Chr1:173781975..173781994 60.13 50 GGAGTGGACGATTTGAAGGA Chr1:173802991..173803010 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000297636 Chr1:173770735..173770834 TGGAGTCTGACTGGACATGG Chr1:173770773..173770792 59.66 55
upstream ENSMUSE00000297626 Chr1:173781934..173782266 AATGGGATTCTTGGGGAGTC Chr1:173781975..173781994 60.13 50

*** Putative Vector Insertion (Chr 1: 173782267 - 173802827) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000297618 Chr1:173802828..173803079 GGAGTGGACGATTTGAAGGA Chr1:173802991..173803010 60.05 50
downstream ENSMUSE00000297609 Chr1:173803436..173803570 GCCAACATCGGAATGAGAAT Chr1:173803523..173803542 59.9 45
downstream ENSMUSE00000297601 Chr1:173814716..173814810 GGACTCTGTGGGTTGAGCAT Chr1:173814783..173814802 60.12 55
downstream ENSMUSE00000297594 Chr1:173815702..173815764 GTGGTCACCGGATCTTTCTT Chr1:173815736..173815755 58.99 50
downstream ENSMUSE00000297589 Chr1:173816492..173816561 CCCAAAGCCTTAGGCAGACT Chr1:173816541..173816560 60.75 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGCTTAGTCTTCAGCCACT Chr1:173794264..173794285 59.13 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCCTTGGATTTACTTTTGA Chr1:173782286..173782307 60.3 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038147