Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32608
Trapped Gene
Zfp74 (ENSMUSG00000059975)
Vector Insertion
Chr 7: 30736732 - 30739107
Public Clones IST14728B10 (tigm) IST11263E11 (tigm) IST10262D3 (tigm) IST10469G4 (tigm)
IST14729E3 (tigm) IST14667E4 (tigm) IST10262D3 (tigm) IST14637H7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000675951 (Chr7:30738874..30739106 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGATCCTTTCGGATTCTTC Chr7:30739087..30739106 59.84 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000675951 (Chr7:30738874..30739106 -)
Downstram Exon
ENSMUSE00000675935 (Chr7:30736733..30736912 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGATCCTTTCGGATTCTTC Chr7:30739087..30739106 59.84 50 GTCCTCGGCAATGTAAGCAT Chr7:30736726..30736745 60.1 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000675951 Chr7:30738874..30739106 GGGATCCTTTCGGATTCTTC Chr7:30739087..30739106 59.84 50
upstream ENSMUSE00000675935 Chr7:30736733..30736912 ATGCTTACATTGCCGAGGAC Chr7:30736748..30736767 60.1 50

*** Putative Vector Insertion (Chr 7: 30736732 - 30739107) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000675957 Chr7:30728651..30728774 AGAACTAAATGCGGGCAGAA Chr7:30728690..30728709 59.85 45
downstream ENSMUSE00000675946 Chr7:30728510..30728524 No primer for this exon
downstream ENSMUSE00000675950 Chr7:30728510..30728564 GAGGTCCTGAGCAAGCTGAA Chr7:30728523..30728542 60.68 55
downstream ENSMUSE00000675956 Chr7:30728510..30728559 No primer for this exon
downstream ENSMUSE00000716328 Chr7:30728510..30728559 No primer for this exon
downstream ENSMUSE00000597290 Chr7:30722961..30723087 TTCCGCTGAGTAGGATCCAG Chr7:30722989..30723008 60.35 55
downstream ENSMUSE00000635760 Chr7:30722619..30722714 ACAGGGTCTCCACAGCACTT Chr7:30722601..30722620 59.76 55
downstream ENSMUSE00000487028 Chr7:30720958..30721062 TGCTCGTCAATTCCCAAAAT Chr7:30721016..30721035 60.45 40
downstream ENSMUSE00000635757 Chr7:30720899..30721062 GAGTCTGCGTTTGGGAAAAA Chr7:30720911..30720930 60.23 45
downstream ENSMUSE00000635756 Chr7:30720882..30720896 No primer for this exon
downstream ENSMUSE00000675939 Chr7:30719261..30721062 GTTGCACTTAAAGGGGGTCA Chr7:30720733..30720752 59.97 50
downstream ENSMUSE00000476576 Chr7:30717818..30721062 GTCTTTTGCATTCGTCAGCA Chr7:30718814..30718833 59.99 45
downstream ENSMUSE00000675934 Chr7:30717810..30721062 GTCTTTTGCATTCGTCAGCA Chr7:30718814..30718833 59.99 45
downstream ENSMUSE00000418502 Chr7:30717362..30717493 CAGAACCCTCGTGACCAGAT Chr7:30717389..30717408 60.11 55
downstream ENSMUSE00000675949 Chr7:30716730..30717259 TCCCGATAAAGGTTCTGACG Chr7:30717179..30717198 60.07 50
downstream ENSMUSE00000675953 Chr7:30715834..30717259 CTGGGAACAAGAATGGCCTA Chr7:30715927..30715946 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000059975