Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32626
Trapped Gene
Syde2 (ENSMUSG00000036863)
Vector Insertion
Chr 3: 145652134 - 145661429
Public Clones IST14797A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361574 (Chr3:145651617..145652133 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCGGTGACTGTCAAGAAA Chr3:145651939..145651958 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361574 (Chr3:145651617..145652133 +)
Downstram Exon
ENSMUSE00000226166 (Chr3:145661430..145662074 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCGGTGACTGTCAAGAAA Chr3:145651939..145651958 60.03 50 TCCTCGCTAAAGGCTGAAGA Chr3:145661748..145661767 60.23 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361574 Chr3:145651617..145652133 CTGCGGTGACTGTCAAGAAA Chr3:145651939..145651958 60.03 50

*** Putative Vector Insertion (Chr 3: 145652134 - 145661429) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000226166 Chr3:145661430..145662074 TCCTCGCTAAAGGCTGAAGA Chr3:145661748..145661767 60.23 50
downstream ENSMUSE00000369644 Chr3:145664287..145665377 TGAACGTGTGGTCCATGTCT Chr3:145665033..145665052 60.01 50
downstream ENSMUSE00000373872 Chr3:145669980..145670106 CCAACAGTCTTGCTGTCCTTC Chr3:145670067..145670087 59.9 52.38
downstream ENSMUSE00000338259 Chr3:145677222..145677403 TCACAACCACTGGACGACAT Chr3:145677342..145677361 60.01 50
downstream ENSMUSE00000381142 Chr3:145678560..145678791 GGCCACCAGTTTCAGATGAT Chr3:145678604..145678623 59.93 50
downstream ENSMUSE00000408060 Chr3:145682767..145684007 TTGTTGAGCTCACGTTCCAG Chr3:145683241..145683260 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGGACCAAAGAATCACACTG Chr3:145652110..145652131 60.02 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCCACTCCTGCTTCTGTGA Chr3:145655124..145655144 59.12 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036863