Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32661
Trapped Gene
Plagl2 (ENSMUSG00000051413)
Vector Insertion
Chr 2: 153063394 - 153067115
Public Clones IST14494F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000441229 (Chr2:153067012..153067114 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000441229 (Chr2:153067012..153067114 -)
Downstram Exon
ENSMUSE00000681635 (Chr2:153063395..153063644 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGCCTGCTCCCTATACACCT Chr2:153063391..153063410 59.72 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000441229 Chr2:153067012..153067114 No primer for this exon
upstream ENSMUSE00000681635 Chr2:153063395..153063644 ATGGGGGAATTTGAACAATG Chr2:153063457..153063476 59.48 40

*** Putative Vector Insertion (Chr 2: 153063394 - 153067115) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000398177 Chr2:153061536..153061908 GTGGTCATGGCAAGGCTAAT Chr2:153061766..153061785 59.96 50
downstream ENSMUSE00000712276 Chr2:153061536..153061908 GTGGTCATGGCAAGGCTAAT Chr2:153061766..153061785 59.96 50
downstream ENSMUSE00000441215 Chr2:153058243..153058455 GGTCCTTTCGGTGAAACATC Chr2:153058360..153058379 59.39 50
downstream ENSMUSE00000441207 Chr2:153056186..153056309 CAGGAGGACGAAGGTGTCAT Chr2:153056242..153056261 60.11 55
downstream ENSMUSE00000473448 Chr2:153055963..153058455 GTGCCTCAGCTTGGGAGTAG Chr2:153057355..153057374 60.01 60
downstream ENSMUSE00000681634 Chr2:153053508..153058455 CCACCTGGGCATGTTAGTCT Chr2:153054384..153054403 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr2:153064045..153064065 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGAGGTTTTCTGGATCAAA Chr2:153064140..153064161 59.16 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051413