Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32665
Trapped Gene
Gck (ENSMUSG00000041798)
Vector Insertion
Chr 11: 5814969 - 5849603
Public Clones IST12453C11 (tigm) IST12453C11 (tigm) IST12310F5 (tigm) IST10949H1 (tigm)
IST14791A3 (tigm) IST14791A3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000663011 (Chr11:5849558..5849602 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGCCACCAAGAAGGAAAAG Chr11:5849558..5849577 60.6 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000663011 (Chr11:5849558..5849602 -)
Downstram Exon
ENSMUSE00000681719 (Chr11:5814970..5815127 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGCCACCAAGAAGGAAAAG Chr11:5849558..5849577 60.6 50 GGGCTCCCCTCCTTGTAGTA Chr11:5814962..5814981 60.46 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000663011 Chr11:5849558..5849602 AGGCCACCAAGAAGGAAAAG Chr11:5849558..5849577 60.6 50
upstream ENSMUSE00000681726 Chr11:5849558..5849602 AGGCCACCAAGAAGGAAAAG Chr11:5849558..5849577 60.6 50
upstream ENSMUSE00000681719 Chr11:5814970..5815127 TTTGCAACACTCAGCCAGAC Chr11:5815090..5815109 60.03 50
upstream ENSMUSE00000681721 Chr11:5814970..5815014 No primer for this exon

*** Putative Vector Insertion (Chr 11: 5814969 - 5849603) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000360261 Chr11:5810865..5811027 CGTAGGTGGGCAACATCTTT Chr11:5810867..5810886 59.99 50
downstream ENSMUSE00000263564 Chr11:5810281..5810435 TCTGGTGTTTCGTCTTCACG Chr11:5810303..5810322 59.87 50
downstream ENSMUSE00000263558 Chr11:5809086..5809205 GCCCAGGGGTAGTTTCTTGT Chr11:5809106..5809125 60.36 55
downstream ENSMUSE00000263552 Chr11:5806686..5806781 AAGTCCCACGATGTTGTTCC Chr11:5806691..5806710 59.83 50
downstream ENSMUSE00000263546 Chr11:5806480..5806579 TCACATTGGCGGTCTTCATA Chr11:5806475..5806494 60.07 45
downstream ENSMUSE00000263540 Chr11:5804364..5804547 GAGGAACTCGTCCAGCTCAC Chr11:5804395..5804414 59.99 60
downstream ENSMUSE00000263533 Chr11:5803103..5803258 TTTCCGCCAATGATCTTTTC Chr11:5803213..5803232 60.02 40
downstream ENSMUSE00000263525 Chr11:5802088..5802321 GAGTGGACACGCTTTCACAG Chr11:5802190..5802209 59.47 55
downstream ENSMUSE00000655919 Chr11:5801666..5801817 TGAAGGTGATTTCGCAGTTG Chr11:5801734..5801753 59.84 45
downstream ENSMUSE00000663010 Chr11:5800826..5801817 TGAGTGTTGAAGCTGCCATC Chr11:5800970..5800989 59.99 50
downstream ENSMUSE00000681722 Chr11:5800826..5801090 TGAGTGTTGAAGCTGCCATC Chr11:5800970..5800989 59.99 50
downstream ENSMUSE00000681718 Chr11:5800823..5801090 TGAGTGTTGAAGCTGCCATC Chr11:5800970..5800989 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGCATCTGCTTCATTTCC Chr11:5843632..5843652 60.74 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGCATCTGCTTCATTTCC Chr11:5843632..5843652 60.74 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041798