Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32677
Trapped Gene
Rreb1 (ENSMUSG00000039087)
Vector Insertion
Chr 13: 37919601 - 37980302
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (ggtc)
5SE047F10 (ggtc) (ggtc) 5SE142E06 (ggtc) (ggtc) 3SE047F10 (ggtc)
(ggtc) 3SE142E06 (ggtc) 5SD124D05 (ggtc) IST14473D11 (tigm) IST14636F11 (tigm)
IST14132G2 (tigm) IST14184H11 (tigm) IST14382G3 (tigm) IST14162G7 (tigm)
IST14301E4 (tigm) IST10899A5 (tigm) IST15004H1 (tigm) IST15001H7 (tigm)
IST14636F11 (tigm) IST15009A9 (tigm) IST14958E2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683167 (Chr13:37919262..37919600 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTTCGCTTTTTCCTCACAC Chr13:37919311..37919330 60 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683167 (Chr13:37919262..37919600 +)
Downstram Exon
ENSMUSE00000642497 (Chr13:37980303..37980549 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTTCGCTTTTTCCTCACAC Chr13:37919311..37919330 60 50 ACTTCGGCACCATAAACACC Chr13:37980371..37980390 59.86 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683176 Chr13:37917908..37918213 CCTCCCTATGGGAGAAGAGG Chr13:37918037..37918056 60.02 60
upstream ENSMUSE00000683166 Chr13:37918801..37918844 No primer for this exon
upstream ENSMUSE00000683167 Chr13:37919262..37919600 GCTTCGCTTTTTCCTCACAC Chr13:37919311..37919330 60 50

*** Putative Vector Insertion (Chr 13: 37919601 - 37980302) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000642497 Chr13:37980303..37980549 ACTTCGGCACCATAAACACC Chr13:37980371..37980390 59.86 50
downstream ENSMUSE00000616470 Chr13:37980740..37980841 GAGCACAGGATTGCAACAAC Chr13:37980762..37980781 59.3 50
downstream ENSMUSE00000616469 Chr13:37984421..37984527 TCTGCCCCAAATGATAGTCC Chr13:37984522..37984541 59.89 50
downstream ENSMUSE00000292709 Chr13:37985641..37987067 CTATGAAGCAACCGAGCACA Chr13:37986359..37986378 60.01 50
downstream ENSMUSE00000683165 Chr13:37985641..37986094 AGGGTGTCCCTTTAGGCAGT Chr13:37985949..37985968 59.99 55
downstream ENSMUSE00000683175 Chr13:37985641..37985853 CTCTGTGACACTCGCTACGC Chr13:37985781..37985800 59.8 60
downstream ENSMUSE00000616467 Chr13:37985743..37985853 TGACACTCGCTACGCTCATT Chr13:37985776..37985795 59.62 50
downstream ENSMUSE00000642478 Chr13:37990281..37990370 CTGGGTGGTGCAAATCTTTT Chr13:37990346..37990365 59.97 45
downstream ENSMUSE00000642493 Chr13:37990281..37990370 CTGGGTGGTGCAAATCTTTT Chr13:37990346..37990365 59.97 45
downstream ENSMUSE00000292696 Chr13:37991493..37991656 CCCATTGGTGGTGAAAGACT Chr13:37991648..37991667 59.82 50
downstream ENSMUSE00000292693 Chr13:38007891..38008029 GTCTTCTGACTCGGCATCGT Chr13:38008014..38008033 60.42 55
downstream ENSMUSE00000292689 Chr13:38008328..38008464 CCTGACTGCCCGTCTTCTAC Chr13:38008353..38008372 59.87 60
downstream ENSMUSE00000292685 Chr13:38019992..38020181 GGAATCGAAGGGTTGTTCTG Chr13:38020120..38020139 59.53 50
downstream ENSMUSE00000292681 Chr13:38021427..38024358 GGATGCGTAGAGCTCGGTAG Chr13:38022843..38022862 60 60
downstream ENSMUSE00000683168 Chr13:38021427..38027401 GGATGCGTAGAGCTCGGTAG Chr13:38022843..38022862 60 60
downstream ENSMUSE00000616466 Chr13:38033412..38033573 TGCTATCATGGGATCCAACA Chr13:38033573..38033592 59.88 45
downstream ENSMUSE00000616465 Chr13:38038726..38039532 GTGCTCTCTTCCACACGACA Chr13:38038957..38038976 60.03 55
downstream ENSMUSE00000541099 Chr13:38040512..38043863 GTTCGCTCACAGGTCTGACA Chr13:38040551..38040570 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGGTGAGACTTCCTGGTTTT Chr13:37973585..37973605 59.18 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGTGAGACTTCCTGGTTTT Chr13:37973585..37973605 59.18 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039087