Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32681
Trapped Gene
9130230L23Rik (ENSMUSG00000054598)
Vector Insertion
Chr 5: 66392470 - 66395525
Public Clones IST12001C7 (tigm) IST12432G4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696831 (Chr5:66395449..66395524 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGCGAAAACTGCCTAGAG Chr5:66395467..66395486 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696831 (Chr5:66395449..66395524 -)
Downstram Exon
ENSMUSE00000696830 (Chr5:66392471..66392678 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGCGAAAACTGCCTAGAG Chr5:66395467..66395486 60.01 55 CAGCTGTCCCTTGAGCTTTC Chr5:66392559..66392578 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696831 Chr5:66395449..66395524 GTGGCGAAAACTGCCTAGAG Chr5:66395467..66395486 60.01 55
upstream ENSMUSE00000696830 Chr5:66392471..66392678 GAGTGCACTGTGCCTACGAA Chr5:66392558..66392577 60.06 55

*** Putative Vector Insertion (Chr 5: 66392470 - 66395525) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000696829 Chr5:66392123..66392216 GTAGGAACCCGGATCCAGTC Chr5:66392111..66392130 60.71 60
downstream ENSMUSE00000696828 Chr5:66391444..66391694 CTTGCTCAACTTCGCCTCTT Chr5:66391468..66391487 59.76 50
downstream ENSMUSE00000452503 Chr5:66381525..66381663 CCATCAGCTCTGGGATCAAT Chr5:66381585..66381604 60.03 50
downstream ENSMUSE00000452497 Chr5:66381077..66381156 No primer for this exon
downstream ENSMUSE00000653111 Chr5:66379167..66379772 CAGGATCGAAATGGAAGGAA Chr5:66379379..66379398 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAAAGAAGGCAGAGCACCA Chr5:66395502..66395522 60.52 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAAGAAGGCAGAGCACCA Chr5:66395502..66395522 60.52 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054598