Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32690
Trapped Gene
Dennd4a (ENSMUSG00000035492)
Vector Insertion
Chr 9: 64760548 - 64764765
Public Clones IST10001D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000532771 (Chr9:64760483..64760547 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTCTCACTTGTGGCACTGG Chr9:64760507..64760526 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000532771 (Chr9:64760483..64760547 +)
Downstram Exon
ENSMUSE00000584216 (Chr9:64764766..64765395 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTCTCACTTGTGGCACTGG Chr9:64760507..64760526 60.02 55 GTTTTTCGGCATTCCATCAC Chr9:64764883..64764902 60.32 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000584221 Chr9:64736767..64737151 GTGTCTGCTGCGTCACTGTT Chr9:64736789..64736808 60.1 55
upstream ENSMUSE00000584220 Chr9:64737397..64737538 No primer for this exon
upstream ENSMUSE00000584219 Chr9:64741093..64741209 GGGGAAAAGGAGAAAAGAGG Chr9:64741173..64741192 59.14 50
upstream ENSMUSE00000584218 Chr9:64742205..64742336 AACATCCGGAGAATGTGAGG Chr9:64742317..64742336 59.93 50
upstream ENSMUSE00000584217 Chr9:64744141..64748749 CATTTCGGGAAGGATCTCAA Chr9:64745059..64745078 60.01 45
upstream ENSMUSE00000389381 Chr9:64744617..64745237 CATTTCGGGAAGGATCTCAA Chr9:64745059..64745078 60.01 45
upstream ENSMUSE00000410808 Chr9:64751957..64752146 TGAAGATGTCTGCCACGAGT Chr9:64752028..64752047 59.42 50
upstream ENSMUSE00000352500 Chr9:64753808..64753902 CCTTGCCTGGAAAATCAGAG Chr9:64753826..64753845 59.81 50
upstream ENSMUSE00000252713 Chr9:64754645..64754820 GGTGTAGGACCTGCGACTGT Chr9:64754667..64754686 60.18 60
upstream ENSMUSE00000252679 Chr9:64754910..64755044 ACTTTGCAAGTCGGACAAGG Chr9:64754948..64754967 60.29 50
upstream ENSMUSE00000345774 Chr9:64757308..64757506 TGCCCGAAGTATTCAGATCC Chr9:64757335..64757354 60.04 50
upstream ENSMUSE00000252625 Chr9:64757738..64757992 CCCTTAGTGGTGTGGAAGGA Chr9:64757801..64757820 59.96 55
upstream ENSMUSE00000252609 Chr9:64759472..64759589 GGCAACCCTTGTACATCCTC Chr9:64759557..64759576 59.41 55
upstream ENSMUSE00000467381 Chr9:64759694..64759720 TCAGAACCGCACTCTTCTGTT Chr9:64759695..64759715 60.04 47.62
upstream ENSMUSE00000386635 Chr9:64760161..64760323 ACCAGGAACTGCTGAAAAGC Chr9:64760212..64760231 59.48 50
upstream ENSMUSE00000532771 Chr9:64760483..64760547 TCTCTCACTTGTGGCACTGG Chr9:64760507..64760526 60.02 55

*** Putative Vector Insertion (Chr 9: 64760548 - 64764765) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000584216 Chr9:64764766..64765395 GTTTTTCGGCATTCCATCAC Chr9:64764883..64764902 60.32 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTCTCACTTGTGGCACTGG Chr9:64760508..64760528 60.02 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTCTCACTTGTGGCACTGG Chr9:64760508..64760528 60.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035492