Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32705
Trapped Gene
Dgkk (ENSMUSG00000062393)
Vector Insertion
Chr X: 6518047 - 6520702
Public Clones IST10618F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000484656 (ChrX:6517936..6518046 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGGCTGGCTGAGTCAAAT ChrX:6518014..6518033 59.7 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000484656 (ChrX:6517936..6518046 +)
Downstram Exon
ENSMUSE00000489307 (ChrX:6520703..6520829 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGGCTGGCTGAGTCAAAT ChrX:6518014..6518033 59.7 45 GCGAGTGTCAGAAGCCTGTT ChrX:6520726..6520745 60.6 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704054 ChrX:6356426..6356762 AGAGTTGGCCTCAGAACTGG ChrX:6356546..6356565 59.45 55
upstream ENSMUSE00000472250 ChrX:6450612..6450722 AGGACCCCTGCTGAAGAACT ChrX:6450626..6450645 60.25 55
upstream ENSMUSE00000473400 ChrX:6452351..6452431 No primer for this exon
upstream ENSMUSE00000467026 ChrX:6454303..6454407 ACTCGGCAAGACATGGAAGA ChrX:6454342..6454361 60.8 50
upstream ENSMUSE00000461005 ChrX:6471679..6471814 TTGTCGGAATGCACTACTGG ChrX:6471707..6471726 59.72 50
upstream ENSMUSE00000462118 ChrX:6472258..6472364 GACCTTCTTCTACCCGCTGA ChrX:6472338..6472357 59.43 55
upstream ENSMUSE00000470159 ChrX:6472631..6472756 GCTGCGGTAGTCATCACAGA ChrX:6472701..6472720 60.02 55
upstream ENSMUSE00000482236 ChrX:6474568..6474670 GAATGTTCCTTCGGAAGTCG ChrX:6474601..6474620 59.67 50
upstream ENSMUSE00000479613 ChrX:6480850..6481033 ACTGGCCACTGACTTGTTCC ChrX:6480886..6480905 60.16 55
upstream ENSMUSE00000469256 ChrX:6481822..6481930 CCGTTTTCGTGTTCTGGTTT ChrX:6481846..6481865 60.01 45
upstream ENSMUSE00000475110 ChrX:6482619..6482758 AATGATCTCGCTCGTGTCCT ChrX:6482652..6482671 59.83 50
upstream ENSMUSE00000471197 ChrX:6483573..6483654 AAGGACAAGTGGCAATGGAT ChrX:6483620..6483639 59.41 45
upstream ENSMUSE00000468229 ChrX:6485799..6485890 ATATCCCACGGAGATGGTCA ChrX:6485861..6485880 60.16 50
upstream ENSMUSE00000488598 ChrX:6501290..6501389 TGTGCTCAGCAGTGGAAGAT ChrX:6501295..6501314 59.58 50
upstream ENSMUSE00000478204 ChrX:6503070..6503298 CGTGCCTCAACTAGACCACA ChrX:6503195..6503214 59.9 55
upstream ENSMUSE00000490447 ChrX:6505050..6505163 No primer for this exon
upstream ENSMUSE00000487458 ChrX:6505575..6505671 CACATTGCACCTGAAACGAT ChrX:6505652..6505671 59.57 45
upstream ENSMUSE00000476606 ChrX:6506993..6507100 GGAATTGGACTAGACGCAAAA ChrX:6507030..6507050 59.22 42.86
upstream ENSMUSE00000481245 ChrX:6510028..6510124 TGCAACGCTCTTACAGGAAA ChrX:6510081..6510100 59.61 45
upstream ENSMUSE00000479333 ChrX:6510364..6510471 CAAGGCATCGTAGTGCTCAA ChrX:6510397..6510416 60.01 50
upstream ENSMUSE00000476403 ChrX:6511090..6511203 CTCGTATCGTCAACCTGCAA ChrX:6511166..6511185 59.86 50
upstream ENSMUSE00000495068 ChrX:6511544..6511678 CAGAAGCCAGGCCTTATCAA ChrX:6511616..6511635 60.34 50
upstream ENSMUSE00000495994 ChrX:6512827..6512987 AATCCAAGCTGTCCAACCAC ChrX:6512871..6512890 59.97 50
upstream ENSMUSE00000496886 ChrX:6513756..6513897 GACCTAAGCAAGGTCCACCA ChrX:6513763..6513782 60.11 55
upstream ENSMUSE00000497801 ChrX:6515426..6515512 AGGGCTCTACGATGACACCA ChrX:6515470..6515489 60.68 55
upstream ENSMUSE00000484656 ChrX:6517936..6518046 ATTGGCTGGCTGAGTCAAAT ChrX:6518014..6518033 59.7 45

*** Putative Vector Insertion (Chr X: 6518047 - 6520702) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000489307 ChrX:6520703..6520829 GCGAGTGTCAGAAGCCTGTT ChrX:6520726..6520745 60.6 55
downstream ENSMUSE00000485437 ChrX:6521771..6523902 TTTCTTCGACGCCAGAACTT ChrX:6521795..6521814 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACAGTTAATCGCCTTGCAG ChrX:6518092..6518112 59.49 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTCGTGACTGGGAAAACC ChrX:6518094..6518114 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062393