Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3272
Trapped Gene
Stk38l (ENSMUSG00000001630)
Vector Insertion
Chr 6: 146717010 - 146717355
Public Clones AH0101 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000197152 (Chr6:146716855..146717009 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000197152 (Chr6:146716855..146717009 +)
Downstram Exon
ENSMUSE00000197150 (Chr6:146717356..146717458 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000369943 Chr6:146673530..146673569 No primer for this exon
upstream ENSMUSE00000688613 Chr6:146673558..146673569 No primer for this exon
upstream ENSMUSE00000410122 Chr6:146706983..146707127 No primer for this exon
upstream ENSMUSE00000715037 Chr6:146706983..146707127 No primer for this exon
upstream ENSMUSE00000278266 Chr6:146708643..146708694 No primer for this exon
upstream ENSMUSE00000278470 Chr6:146714717..146714839 No primer for this exon
upstream ENSMUSE00000197161 Chr6:146715260..146715343 No primer for this exon
upstream ENSMUSE00000197162 Chr6:146715941..146716064 No primer for this exon
upstream ENSMUSE00000197152 Chr6:146716855..146717009 No primer for this exon

*** Putative Vector Insertion (Chr 6: 146717010 - 146717355) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000197150 Chr6:146717356..146717458 No primer for this exon
downstream ENSMUSE00000197155 Chr6:146717617..146717678 No primer for this exon
downstream ENSMUSE00000197158 Chr6:146720104..146720221 No primer for this exon
downstream ENSMUSE00000197159 Chr6:146720620..146720743 No primer for this exon
downstream ENSMUSE00000278366 Chr6:146721840..146721935 No primer for this exon
downstream ENSMUSE00000278314 Chr6:146723922..146724013 No primer for this exon
downstream ENSMUSE00000688612 Chr6:146724095..146725078 No primer for this exon
downstream ENSMUSE00000401018 Chr6:146724116..146727324 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACGTCAAACCAGACAACC Chr6:146716974..146716994 60.41 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGACGTCAAACCAGACAACC Chr6:146716974..146716994 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001630