Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32727
Trapped Gene
Slc5a4b (ENSMUSG00000020226)
Vector Insertion
Chr 10: 75553423 - 75566674
Public Clones IST14820H7 (tigm) IST10256G1 (tigm) IST10256G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000102002 (Chr10:75566569..75566673 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000102002 (Chr10:75566569..75566673 -)
Downstram Exon
ENSMUSE00000102018 (Chr10:75553424..75553529 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000575521 Chr10:75573547..75573706 No primer for this exon
upstream ENSMUSE00000708818 Chr10:75573547..75573706 No primer for this exon
upstream ENSMUSE00000102009 Chr10:75572763..75572834 No primer for this exon
upstream ENSMUSE00000101994 Chr10:75571243..75571347 No primer for this exon
upstream ENSMUSE00000102020 Chr10:75569452..75569511 No primer for this exon
upstream ENSMUSE00000102002 Chr10:75566569..75566673 No primer for this exon
upstream ENSMUSE00000102018 Chr10:75553424..75553529 No primer for this exon

*** Putative Vector Insertion (Chr 10: 75553423 - 75566674) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000102024 Chr10:75552651..75552731 No primer for this exon
downstream ENSMUSE00000102016 Chr10:75544061..75544281 No primer for this exon
downstream ENSMUSE00000469566 Chr10:75537725..75537860 No primer for this exon
downstream ENSMUSE00000355911 Chr10:75535173..75535283 No primer for this exon
downstream ENSMUSE00000720694 Chr10:75535173..75535280 No primer for this exon
downstream ENSMUSE00000503522 Chr10:75533249..75533399 No primer for this exon
downstream ENSMUSE00000224132 Chr10:75526699..75526867 No primer for this exon
downstream ENSMUSE00000224119 Chr10:75524959..75525174 No primer for this exon
downstream ENSMUSE00000102021 Chr10:75523095..75523199 No primer for this exon
downstream ENSMUSE00000713615 Chr10:75523094..75523199 No primer for this exon
downstream ENSMUSE00000413788 Chr10:75520240..75521644 No primer for this exon
downstream ENSMUSE00000720596 Chr10:75520239..75521644 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCAGGGATGCCTGGACTAC Chr10:75566657..75566677 60.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAGGGATGCCTGGACTAC Chr10:75566657..75566677 60.07 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020226