Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32733
Trapped Gene
4933406E20Rik (ENSMUSG00000006675)
Vector Insertion
Chr 9: 108499229 - 108499932
Public Clones IST11093F8 (tigm) IST10407H1 (tigm) IST14975H4 (tigm) IST11093F8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221368 (Chr9:108499539..108499931 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221368 (Chr9:108499539..108499931 -)
Downstram Exon
ENSMUSE00000240493 (Chr9:108499230..108499311 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221368 Chr9:108499539..108499931 No primer for this exon
upstream ENSMUSE00000240493 Chr9:108499230..108499311 No primer for this exon

*** Putative Vector Insertion (Chr 9: 108499229 - 108499932) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583242 Chr9:108485973..108486163 No primer for this exon
downstream ENSMUSE00000583241 Chr9:108485178..108485274 No primer for this exon
downstream ENSMUSE00000583240 Chr9:108484173..108484335 No primer for this exon
downstream ENSMUSE00000583239 Chr9:108483050..108483235 No primer for this exon
downstream ENSMUSE00000583238 Chr9:108482347..108482437 No primer for this exon
downstream ENSMUSE00000583237 Chr9:108482047..108482170 No primer for this exon
downstream ENSMUSE00000583236 Chr9:108481157..108481639 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr9:108499861..108499881 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000006675