Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32738
Trapped Gene
Cabin1 (ENSMUSG00000020196)
Vector Insertion
Chr 10: 75218113 - 75227103
Public Clones IST14565C4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000575579 (Chr10:75226770..75227102 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000575579 (Chr10:75226770..75227102 -)
Downstram Exon
ENSMUSE00000611584 (Chr10:75218114..75218245 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000575579 Chr10:75226770..75227102 No primer for this exon
upstream ENSMUSE00000611584 Chr10:75218114..75218245 No primer for this exon

*** Putative Vector Insertion (Chr 10: 75218113 - 75227103) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000575571 Chr10:75217557..75217649 No primer for this exon
downstream ENSMUSE00000575570 Chr10:75216996..75217109 No primer for this exon
downstream ENSMUSE00000575569 Chr10:75216122..75216256 No primer for this exon
downstream ENSMUSE00000575568 Chr10:75214181..75214361 No primer for this exon
downstream ENSMUSE00000575567 Chr10:75212789..75212918 No primer for this exon
downstream ENSMUSE00000575566 Chr10:75210571..75210720 No primer for this exon
downstream ENSMUSE00000575565 Chr10:75209233..75209519 No primer for this exon
downstream ENSMUSE00000575564 Chr10:75207974..75208142 No primer for this exon
downstream ENSMUSE00000575563 Chr10:75205947..75206083 No primer for this exon
downstream ENSMUSE00000575562 Chr10:75204990..75205207 No primer for this exon
downstream ENSMUSE00000575561 Chr10:75202765..75202843 No primer for this exon
downstream ENSMUSE00000575560 Chr10:75202071..75202258 No primer for this exon
downstream ENSMUSE00000575559 Chr10:75200956..75201108 No primer for this exon
downstream ENSMUSE00000575558 Chr10:75200066..75200260 No primer for this exon
downstream ENSMUSE00000575557 Chr10:75197711..75197953 No primer for this exon
downstream ENSMUSE00000575556 Chr10:75196365..75196521 No primer for this exon
downstream ENSMUSE00000575555 Chr10:75195145..75195260 No primer for this exon
downstream ENSMUSE00000575554 Chr10:75189603..75189764 No primer for this exon
downstream ENSMUSE00000575535 Chr10:75188344..75188500 No primer for this exon
downstream ENSMUSE00000101788 Chr10:75188294..75188500 No primer for this exon
downstream ENSMUSE00000642564 Chr10:75188004..75188149 No primer for this exon
downstream ENSMUSE00000666148 Chr10:75185506..75185529 No primer for this exon
downstream ENSMUSE00000666147 Chr10:75185272..75185288 No primer for this exon
downstream ENSMUSE00000642563 Chr10:75184023..75184284 No primer for this exon
downstream ENSMUSE00000642562 Chr10:75180183..75180443 No primer for this exon
downstream ENSMUSE00000642561 Chr10:75178344..75178495 No primer for this exon
downstream ENSMUSE00000642560 Chr10:75176198..75176376 No primer for this exon
downstream ENSMUSE00000642559 Chr10:75162658..75162840 No primer for this exon
downstream ENSMUSE00000642558 Chr10:75157460..75157791 No primer for this exon
downstream ENSMUSE00000642557 Chr10:75147037..75147150 No primer for this exon
downstream ENSMUSE00000642556 Chr10:75121379..75121542 No primer for this exon
downstream ENSMUSE00000642555 Chr10:75120541..75120637 No primer for this exon
downstream ENSMUSE00000642553 Chr10:75119520..75120197 No primer for this exon
downstream ENSMUSE00000611579 Chr10:75118111..75118185 No primer for this exon
downstream ENSMUSE00000611578 Chr10:75115620..75115887 No primer for this exon
downstream ENSMUSE00000611577 Chr10:75110802..75110966 No primer for this exon
downstream ENSMUSE00000611576 Chr10:75109620..75109846 No primer for this exon
downstream ENSMUSE00000575572 Chr10:75108855..75109432 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTGGTGCTGAATCTCTGA Chr10:75221117..75221137 60.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTGGTGCTGAATCTCTGA Chr10:75221117..75221137 60.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020196