Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32752
Trapped Gene
Pou2f3 (ENSMUSG00000032015)
Vector Insertion
Chr 9: 42984368 - 43007182
Public Clones (ggtc) IST14947F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000215810 (Chr9:43007113..43007181 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACTTTCGGTCAAGTGGAG Chr9:43007117..43007136 60.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000215810 (Chr9:43007113..43007181 -)
Downstram Exon
ENSMUSE00000267430 (Chr9:42984369..42984403 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACTTTCGGTCAAGTGGAG Chr9:43007117..43007136 60.83 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444588 Chr9:43013737..43013838 GCAGGATGGTGAATCTGGAG Chr9:43013750..43013769 60.62 55
upstream ENSMUSE00000215810 Chr9:43007113..43007181 GCACTTTCGGTCAAGTGGAG Chr9:43007117..43007136 60.83 55
upstream ENSMUSE00000267430 Chr9:42984369..42984403 TCGAAATGGCCTAGATTTCAA Chr9:42984376..42984396 59.67 38.1

*** Putative Vector Insertion (Chr 9: 42984368 - 43007182) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000267410 Chr9:42954893..42954997 CACCCAGATCCTCCGTCTTA Chr9:42954954..42954973 60.06 55
downstream ENSMUSE00000215802 Chr9:42953302..42953404 GCTGGAGTGGATGGAGAGAA Chr9:42953355..42953374 60.35 55
downstream ENSMUSE00000215805 Chr9:42950798..42950880 TGCTTTGTTGCTGTGGAAAG Chr9:42950817..42950836 60.03 45
downstream ENSMUSE00000215807 Chr9:42947903..42948085 TTGAAGGTCTTGGCGAACTT Chr9:42947912..42947931 59.85 45
downstream ENSMUSE00000515283 Chr9:42947399..42947540 TGGCTGAAGTCATTGCCATA Chr9:42947469..42947488 60.22 45
downstream ENSMUSE00000215811 Chr9:42945378..42945514 ACTTCGCTGAGAGTGGGGTA Chr9:42945432..42945451 59.87 55
downstream ENSMUSE00000215803 Chr9:42942562..42942723 ATCGATAACTGCTCCGCAAT Chr9:42942649..42942668 59.7 45
downstream ENSMUSE00000215801 Chr9:42936961..42937027 GTGGACAGGAGGGACTGAGA Chr9:42936958..42936977 60.24 60
downstream ENSMUSE00000215800 Chr9:42935399..42935540 AGTCCTGAACCAGGAGACGA Chr9:42935461..42935480 59.83 55
downstream ENSMUSE00000517811 Chr9:42932022..42933213 ACAACATGGCCAGAGGGTAG Chr9:42932524..42932543 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGAGAAGGAATGGGGATT Chr9:42998168..42998188 59.59 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGAGAAGGAATGGGGATT Chr9:42998168..42998188 59.59 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032015