Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32766
Trapped Gene
AL732617.24 (ENSMUSG00000081660)
Vector Insertion
Chr 4: 3425963 - 3433397
Public Clones IST13050E5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000708079 (Chr4:3433244..3433396 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGACTGGAGAAGCCATGC Chr4:3433356..3433375 59.96 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000708079 (Chr4:3433244..3433396 -)
Downstram Exon
ENSMUSE00000711753 (Chr4:3425964..3426146 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGACTGGAGAAGCCATGC Chr4:3433356..3433375 59.96 55 TGTAGATGGGCTCCTCCTTG Chr4:3425966..3425985 60.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000721253 Chr4:3443531..3443662 TGTGAGAGATCCAACGTCCA Chr4:3443548..3443567 60.25 50
upstream ENSMUSE00000721781 Chr4:3439889..3439934 No primer for this exon
upstream ENSMUSE00000713256 Chr4:3438942..3439047 ACCCTTATGATGGCATCCAC Chr4:3438992..3439011 59.63 50
upstream ENSMUSE00000708166 Chr4:3436651..3436749 AAGCCAAGTCCCTTTCATCA Chr4:3436713..3436732 59.67 45
upstream ENSMUSE00000714281 Chr4:3436441..3436544 TCTGGCACGAGAGAACAGTG Chr4:3436480..3436499 60.18 55
upstream ENSMUSE00000713819 Chr4:3435195..3435344 TCTCCTCGCATCACTTTTCC Chr4:3435227..3435246 60.34 50
upstream ENSMUSE00000708079 Chr4:3433244..3433396 GAAGACTGGAGAAGCCATGC Chr4:3433356..3433375 59.96 55
upstream ENSMUSE00000711753 Chr4:3425964..3426146 CATCATCACCGAGTTCATGG Chr4:3425970..3425989 59.92 50

*** Putative Vector Insertion (Chr 4: 3425963 - 3433397) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000716592 Chr4:3424125..3424201 ACCTTGCCACCTTCATCACT Chr4:3424137..3424156 59.58 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGACTGGAGAAGCCATGC Chr4:3430354..3430374 59.96 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGACTGGAGAAGCCATGC Chr4:3430354..3430374 59.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000081660