Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32773
Trapped Gene
Arhgef3 (ENSMUSG00000021895)
Vector Insertion
Chr 14: 28176084 - 28192776
Public Clones IST14422F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000650209 (Chr14:28175976..28176083 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACATCGCTAGCAAACCTCA Chr14:28176014..28176033 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000650209 (Chr14:28175976..28176083 +)
Downstram Exon
ENSMUSE00000650208 (Chr14:28192777..28192947 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACATCGCTAGCAAACCTCA Chr14:28176014..28176033 60.01 50 CGTGAGCACCTGATTGACAC Chr14:28192926..28192945 60.32 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650210 Chr14:28051225..28051339 ACTTAGCAGCCAGGGAATTG Chr14:28051263..28051282 59.34 50
upstream ENSMUSE00000563302 Chr14:28078709..28078771 GTTCCCAGGATGAAGATGCT Chr14:28078725..28078744 59.09 50
upstream ENSMUSE00000563242 Chr14:28149363..28149455 CTCACTGTCAAGAGGGCAAA Chr14:28149390..28149409 59.01 50
upstream ENSMUSE00000650209 Chr14:28175976..28176083 CACATCGCTAGCAAACCTCA Chr14:28176014..28176033 60.01 50

*** Putative Vector Insertion (Chr 14: 28176084 - 28192776) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000650208 Chr14:28192777..28192947 CGTGAGCACCTGATTGACAC Chr14:28192926..28192945 60.32 55
downstream ENSMUSE00000650207 Chr14:28197340..28197402 No primer for this exon
downstream ENSMUSE00000650206 Chr14:28199031..28199127 GAGTCCAGGGTCCCAAAAAT Chr14:28199110..28199129 60.17 50
downstream ENSMUSE00000650205 Chr14:28199279..28199355 GTTTCCGAACATCTCGAAGC Chr14:28199314..28199333 59.82 50
downstream ENSMUSE00000650204 Chr14:28207119..28207376 TAAACAGCGCTGGAGGAAGT Chr14:28207235..28207254 60.01 50
downstream ENSMUSE00000650203 Chr14:28210749..28210919 TAATAGCGGCATTCCGATTC Chr14:28210819..28210838 60.03 45
downstream ENSMUSE00000650202 Chr14:28213451..28213637 GATGGGCTGTCGGTACAACT Chr14:28213549..28213568 60 55
downstream ENSMUSE00000445957 Chr14:28214816..28217090 CCAGTCCATGCAGAGCAGTA Chr14:28215471..28215490 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGGCCCTTATTTTGTTCA Chr14:28185048..28185068 60.07 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAGAACTTGAGCCGTGACT Chr14:28185121..28185142 59.65 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021895