Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32776
Trapped Gene
Sobp (ENSMUSG00000038248)
Vector Insertion
Chr 10: 42740787 - 42794495
Public Clones IST14248F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000643913 (Chr10:42794399..42794494 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAAGATGGACGTGCTGAAA Chr10:42794467..42794486 60.39 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000643913 (Chr10:42794399..42794494 -)
Downstram Exon
ENSMUSE00000643912 (Chr10:42740788..42742724 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAAGATGGACGTGCTGAAA Chr10:42794467..42794486 60.39 45 TCCTCGGACGACAGTAGCTT Chr10:42741114..42741133 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000576444 Chr10:42893782..42894336 CTAGAAGAGACCCCGCTCCT Chr10:42894048..42894067 59.97 60
upstream ENSMUSE00000396349 Chr10:42880512..42880650 CCTTGGCTGGTATGGCTATG Chr10:42880602..42880621 60.48 55
upstream ENSMUSE00000643905 Chr10:42877714..42877899 ACTCACCTGCTGGGTCAAAG Chr10:42877778..42877797 60.3 55
upstream ENSMUSE00000643903 Chr10:42847585..42847736 GTATGGGAAGCGAGGTGAAA Chr10:42847645..42847664 60.07 50
upstream ENSMUSE00000643913 Chr10:42794399..42794494 TGAAGATGGACGTGCTGAAA Chr10:42794467..42794486 60.39 45
upstream ENSMUSE00000643912 Chr10:42740788..42742724 ACCCCAATAGTCCCTTGTCC Chr10:42742113..42742132 60.05 55

*** Putative Vector Insertion (Chr 10: 42740787 - 42794495) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000420244 Chr10:42722307..42724220 GTCTCGCTGACTTCCTGGAC Chr10:42723214..42723233 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCTTCCCTAATCGCCTTG Chr10:42791433..42791453 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGAAGATGGACGTGCTGAA Chr10:42791466..42791486 59.24 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038248