Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32797
Trapped Gene
Mme (ENSMUSG00000027820)
Vector Insertion
Chr 3: 63172879 - 63184154
Public Clones IST10252E2 (tigm) IST14329D6 (tigm) IST14639G2 (tigm) IST11922E4 (tigm)
IST14096B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000261590 (Chr3:63172802..63172878 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGACCTACCGGCCAGAGTAT Chr3:63172812..63172831 60.35 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000261590 (Chr3:63172802..63172878 +)
Downstram Exon
ENSMUSE00000674701 (Chr3:63184155..63185545 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGACCTACCGGCCAGAGTAT Chr3:63172812..63172831 60.35 60 AAATCTTGCCGTGGATGTTC Chr3:63184292..63184311 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000441075 Chr3:63099794..63099871 No primer for this exon
upstream ENSMUSE00000674702 Chr3:63100106..63100244 CCATTCCGCTGTACAGACAC Chr3:63100203..63100222 59.17 55
upstream ENSMUSE00000371119 Chr3:63104047..63104216 CATAGCGGTGACAATGATCG Chr3:63104176..63104195 60.1 50
upstream ENSMUSE00000173285 Chr3:63104901..63104936 No primer for this exon
upstream ENSMUSE00000173291 Chr3:63130636..63130797 GTCATTCCCGAGACCAGTTC Chr3:63130725..63130744 59.51 55
upstream ENSMUSE00000173280 Chr3:63131707..63131787 TGCAGAAAGCAAAAACCTTG Chr3:63131746..63131765 59.08 40
upstream ENSMUSE00000173283 Chr3:63131894..63131989 AGGCGGACAACCTCTACTCA Chr3:63131910..63131929 59.87 55
upstream ENSMUSE00000173296 Chr3:63132092..63132210 GCACTTCTTGGACAGCTGAG Chr3:63132092..63132111 58.75 55
upstream ENSMUSE00000173282 Chr3:63133572..63133637 GCCTCCCTTCCAGAGACTACT Chr3:63133591..63133611 58.96 57.14
upstream ENSMUSE00000173289 Chr3:63143938..63144072 TTCTGTGGCCAGACTGATTC Chr3:63143967..63143986 58.8 50
upstream ENSMUSE00000261680 Chr3:63145829..63145930 GAAATGACCCAATGCTGCTT Chr3:63145851..63145870 60.08 45
upstream ENSMUSE00000173287 Chr3:63147419..63147555 GCTGGTCAAATTTCACAAATGA Chr3:63147426..63147447 59.98 36.36
upstream ENSMUSE00000173284 Chr3:63147664..63147757 GCCTCAGCCGAAACTACAAG Chr3:63147714..63147733 60.01 55
upstream ENSMUSE00000173293 Chr3:63149047..63149175 TTTATGTGGAAGCGGCTTTT Chr3:63149135..63149154 59.72 40
upstream ENSMUSE00000173295 Chr3:63149976..63150074 TGACCTTACTTGGATGGATGC Chr3:63150026..63150046 59.95 47.62
upstream ENSMUSE00000173298 Chr3:63151059..63151139 GCCTTGGCAATTAAAGAAAGG Chr3:63151059..63151079 60.08 42.86
upstream ENSMUSE00000173297 Chr3:63152540..63152643 GCTCCGAGAAAAAGTGGACA Chr3:63152617..63152636 60.38 50
upstream ENSMUSE00000173294 Chr3:63162828..63162886 CCTCAGGCCGAAATCAGATA Chr3:63162866..63162885 60.17 50
upstream ENSMUSE00000568019 Chr3:63165854..63165973 GCATGGTCATTGGACATGAA Chr3:63165929..63165948 60.34 45
upstream ENSMUSE00000261620 Chr3:63168684..63168817 ATGGAGACCTCGTTGACTGG Chr3:63168702..63168721 60.11 55
upstream ENSMUSE00000261611 Chr3:63168919..63168984 GGTATTGGCCAAGCATACAGA Chr3:63168964..63168984 59.97 47.62
upstream ENSMUSE00000261602 Chr3:63172401..63172496 No primer for this exon
upstream ENSMUSE00000261590 Chr3:63172802..63172878 GGACCTACCGGCCAGAGTAT Chr3:63172812..63172831 60.35 60

*** Putative Vector Insertion (Chr 3: 63172879 - 63184154) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000493048 Chr3:63184155..63186153 AAATCTTGCCGTGGATGTTC Chr3:63184292..63184311 59.94 45
downstream ENSMUSE00000674701 Chr3:63184155..63185545 AAATCTTGCCGTGGATGTTC Chr3:63184292..63184311 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr3:63172929..63172949 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTTACCGTGACTGGGAAA Chr3:63178923..63178943 58.62 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027820