Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32803
Trapped Gene
Sdro (ENSMUSG00000040127)
Vector Insertion
Chr 10: 127340798 - 127346800
Public Clones IST10131G12 (tigm) IST10134E12 (tigm) IST14691H2 (tigm) IST14713B9 (tigm)
IST14691H2 (tigm) IST14917D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000515950 (Chr10:127340634..127340797 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGAATCACGCATGAAGAAG Chr10:127340717..127340736 59.8 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000515950 (Chr10:127340634..127340797 +)
Downstram Exon
ENSMUSE00000399871 (Chr10:127346801..127348806 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGAATCACGCATGAAGAAG Chr10:127340717..127340736 59.8 45 TCCTGTGGGCTAGATTGTCC Chr10:127347349..127347368 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435278 Chr10:127335591..127336001 GGAGAACGTCAAGGAAGCAG Chr10:127335949..127335968 59.99 55
upstream ENSMUSE00000274114 Chr10:127339212..127339470 GCTATATTCGGCGGTGGTTA Chr10:127339406..127339425 59.95 50
upstream ENSMUSE00000515950 Chr10:127340634..127340797 TGGAATCACGCATGAAGAAG Chr10:127340717..127340736 59.8 45

*** Putative Vector Insertion (Chr 10: 127340798 - 127346800) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000399871 Chr10:127346801..127348806 TCCTGTGGGCTAGATTGTCC Chr10:127347349..127347368 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCTGGGGGTTTGGTAATC Chr10:127346834..127346854 60.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAGAGTAGGCCAGCAAGCAG Chr10:127346821..127346842 59.43 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040127