Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI32829
Trapped Gene
Osbpl3 (ENSMUSG00000029822)
Vector Insertion
Chr 6: 50332788 - 50378420
Public Clones (egtc) IST14606G12 (tigm) IST14601G8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000506925 (Chr6:50378328..50378419 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTCCTGTGTCAGCGAAGA Chr6:50378398..50378417 60.18 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000506925 (Chr6:50378328..50378419 -)
Downstram Exon
ENSMUSE00000481934 (Chr6:50332789..50332836 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTCCTGTGTCAGCGAAGA Chr6:50378398..50378417 60.18 55 CTGCGGTAAAGTATGCAGGA Chr6:50332775..50332794 58.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000617161 Chr6:50405824..50406081 TCCTTCTCGGTCTGAAGCAC Chr6:50405867..50405886 60.53 55
upstream ENSMUSE00000506925 Chr6:50378328..50378419 CTGTCCTGTGTCAGCGAAGA Chr6:50378398..50378417 60.18 55
upstream ENSMUSE00000481934 Chr6:50332789..50332836 TGCATACTTTACCGCAGTGG Chr6:50332794..50332813 59.75 50

*** Putative Vector Insertion (Chr 6: 50332788 - 50378420) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000277002 Chr6:50320122..50320357 GTGAAGAGCTGGTCCTTTGG Chr6:50320194..50320213 59.84 55
downstream ENSMUSE00000699462 Chr6:50320122..50320214 CACCGAGATTCTTCTCGTCA Chr6:50320168..50320187 58.96 50
downstream ENSMUSE00000193079 Chr6:50302984..50303100 TTTCCCCTCTCAATCCTTCC Chr6:50303042..50303061 60.38 50
downstream ENSMUSE00000193100 Chr6:50302783..50302836 GCTTGGCTCTTGGCATATTT Chr6:50302765..50302784 59.32 45
downstream ENSMUSE00000193088 Chr6:50301843..50301956 TCCTCCGTGTCTAGGTCGAT Chr6:50301840..50301859 59.68 55
downstream ENSMUSE00000276969 Chr6:50297970..50298137 GGAAACATGGCGATCTCATT Chr6:50298030..50298049 59.9 45
downstream ENSMUSE00000276960 Chr6:50297365..50297488 GGGTGGAAATGAATTCTGCT Chr6:50297431..50297450 58.98 45
downstream ENSMUSE00000276950 Chr6:50296327..50296430 GCTCATTTCCAGCAGGTAGG Chr6:50296371..50296390 59.84 55
downstream ENSMUSE00000561528 Chr6:50296010..50296102 CCTGTGTGGTCGTTTTTCCT Chr6:50296036..50296055 60.01 50
downstream ENSMUSE00000193078 Chr6:50294873..50295029 AAAGTCCAGCGTCGACAAGT Chr6:50294939..50294958 59.91 50
downstream ENSMUSE00000193106 Chr6:50286214..50286344 GATGACAGAGCGTGCTTCAG Chr6:50286193..50286212 59.73 55
downstream ENSMUSE00000193084 Chr6:50283185..50283292 GGATTCTGCGTAAGCGTTCT Chr6:50283225..50283244 59.48 50
downstream ENSMUSE00000193099 Chr6:50278669..50278803 GGGAGTCGGTGATAGACAGC Chr6:50278706..50278725 59.69 60
downstream ENSMUSE00000193110 Chr6:50277374..50277467 No primer for this exon
downstream ENSMUSE00000193087 Chr6:50272972..50273222 CCAGAAGCTCGCTGTATTCC Chr6:50272988..50273007 59.98 55
downstream ENSMUSE00000193092 Chr6:50270036..50270173 TGCATTCGTACGTTTCTCCA Chr6:50270052..50270071 60.26 45
downstream ENSMUSE00000193077 Chr6:50262631..50262694 ACAAAGTTTCCGGACTCAGC Chr6:50262620..50262639 59.33 50
downstream ENSMUSE00000193074 Chr6:50259312..50259390 TTCCATGGATTTACCCCAGA Chr6:50259328..50259347 60.13 45
downstream ENSMUSE00000699468 Chr6:50259312..50259388 TTCCATGGATTTACCCCAGA Chr6:50259328..50259347 60.13 45
downstream ENSMUSE00000193086 Chr6:50258290..50258434 TGTCAATTTCGCCATAGTGC Chr6:50258318..50258337 59.69 45
downstream ENSMUSE00000193109 Chr6:50253016..50253160 AGATGCTCTCGTGCCATTTC Chr6:50253036..50253055 60.37 50
downstream ENSMUSE00000193082 Chr6:50250923..50251049 GAGTGTCGGTGGGTGGTAAT Chr6:50250920..50250939 59.7 55
downstream ENSMUSE00000193111 Chr6:50249315..50249437 CTCTGCAGCTTCTCGATCCT Chr6:50249350..50249369 59.85 55
downstream ENSMUSE00000699460 Chr6:50247064..50247160 TCACCATAAGACGGGATGGT Chr6:50247042..50247061 60.19 50
downstream ENSMUSE00000699463 Chr6:50246806..50247160 TCAGCGCTTACAATGCTACG Chr6:50246909..50246928 60.18 50
downstream ENSMUSE00000193108 Chr6:50246800..50247160 TCAGCGCTTACAATGCTACG Chr6:50246909..50246928 60.18 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCAAGTGGAGTGGTTAGAG Chr6:50357379..50357400 60.3 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTTAGCAGCCACCCAGAA Chr6:50348413..50348433 60.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTATAATCGCCTTGCAGCAC Chr6:50357259..50357279 58.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGAACGTGACTGGGAAAACC Chr6:50357260..50357280 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029822